EMAIL THIS PAGE TO A FRIEND

MRPS17

mitochondrial ribosomal protein S17

43 Gene Product Result for
Synonyms: HSPC011 MRP-S17 RPMS17 S17mt
UniProtKB ID: Q9Y2R5, Q86X15
Gene ID:
Human(51373) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S17P family. The encoded protein is moderately conserved between human mitochondrial and prokaryotic ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 1p, 3p, 6q, 14p, 18q, and Xq. [provided by RefSeq, Jul 2008]
Mouse(66258) mitochondrial ribosomal protein S17
Rat(288621) mitochondrial ribosomal protein S17
fruit fly(37872) mitochondrial ribosomal protein S17
chicken(417538) mitochondrial ribosomal protein S17
cow(508143) mitochondrial ribosomal protein S17
domestic cat(101082711) mitochondrial ribosomal protein S17
dog(100688077) mitochondrial ribosomal protein S17
sheep(101108014) mitochondrial ribosomal protein S17
naked mole-rat(101697932) mitochondrial ribosomal protein S17
domestic guinea pig(100719305) mitochondrial ribosomal protein S17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015969 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004091 MISSION® esiRNA esiRNA targeting mouse Mrps17 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015969 Rosetta Predictions human pricing
NM_001105923 Rosetta Predictions rat pricing
NM_025450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179450 predicted 238
2 SASI_Hs01_00179452 predicted 342
3 SASI_Hs01_00179453 predicted 318
4 SASI_Hs01_00179454 predicted 222
5 SASI_Hs01_00179455 predicted 245
6 SASI_Hs01_00179456 predicted 258
7 SASI_Hs02_00348636 predicted 237
8 SASI_Hs01_00179457 predicted 347
9 SASI_Hs01_00179458 predicted 353
10 SASI_Hs01_00179459 predicted 320
11 SASI_Hs01_00179451 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213872 predicted 1072
2 SASI_Rn02_00213873 predicted 584
3 SASI_Rn02_00213874 predicted 1058
4 SASI_Rn02_00213875 predicted 907
5 SASI_Rn02_00213876 predicted 773
6 SASI_Rn02_00213877 predicted 604
7 SASI_Rn02_00213878 predicted 813
8 SASI_Rn02_00213879 predicted 734
9 SASI_Rn02_00213880 predicted 478
10 SASI_Rn02_00213881 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167346 predicted 855
2 SASI_Mm01_00167347 predicted 517
3 SASI_Mm01_00167348 predicted 834
4 SASI_Mm01_00167349 predicted 338
5 SASI_Mm01_00167350 predicted 757
6 SASI_Mm01_00167351 predicted 873
7 SASI_Mm01_00167352 predicted 825
8 SASI_Mm01_00167353 predicted 800
9 SASI_Mm01_00167354 predicted 444
10 SASI_Mm01_00167355 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025450
VALIDATED
MRPS17 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S17
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025450.4-806s21c1
Sequence:CCGGCTGAACTGAAGGTACTGATTACTCGAGTAATCAGTACCTTCAGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-597s21c1
Sequence:CCGGTGCAGGAACTGCCTACCTAGACTCGAGTCTAGGTAGGCAGTTCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025450.4-836s21c1
Sequence:CCGGCCTAAGGATGCGGCATCATTTCTCGAGAAATGATGCCGCATCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-510s21c1
Sequence:CCGGCCCACGATCGAAGCATGTGAACTCGAGTTCACATGCTTCGATCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-552s21c1
Sequence:CCGGCTTCAAAGTCGGCCGAGTTATCTCGAGATAACTCGGCCGACTTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-484s21c1
Sequence:CCGGATCGTGCTCCTCAGAGCTTTGCTCGAGCAAAGCTCTGAGGAGCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-444s21c1
Sequence:CCGGCTTTGCTCACGATGCCCTTCACTCGAGTGAAGGGCATCGTGAGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-879s1c1
Sequence:CCGGCGTATGTATTGTCTCATTGTTCTCGAGAACAATGAGACAATACATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-348s1c1
Sequence:CCGGTGATTGGTACAGCCATGATAACTCGAGTTATCATGGCTGTACCAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-407s1c1
Sequence:CCGGCCCTACTTACTGAAGTACTTTCTCGAGAAAGTACTTCAGTAAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-518s1c1
Sequence:CCGGTCGAAGCATGTGAAGCACGAACTCGAGTTCGTGCTTCACATGCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025450.1-374s1c1
Sequence:CCGGGCTAAAGTAAGAGCGACCAGACTCGAGTCTGGTCGCTCTTACTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025450
VALIDATED
MRPS17 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S17
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025450.4-806s21c1
Sequence:CCGGCTGAACTGAAGGTACTGATTACTCGAGTAATCAGTACCTTCAGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-597s21c1
Sequence:CCGGTGCAGGAACTGCCTACCTAGACTCGAGTCTAGGTAGGCAGTTCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025450.4-836s21c1
Sequence:CCGGCCTAAGGATGCGGCATCATTTCTCGAGAAATGATGCCGCATCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-510s21c1
Sequence:CCGGCCCACGATCGAAGCATGTGAACTCGAGTTCACATGCTTCGATCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-552s21c1
Sequence:CCGGCTTCAAAGTCGGCCGAGTTATCTCGAGATAACTCGGCCGACTTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-484s21c1
Sequence:CCGGATCGTGCTCCTCAGAGCTTTGCTCGAGCAAAGCTCTGAGGAGCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-444s21c1
Sequence:CCGGCTTTGCTCACGATGCCCTTCACTCGAGTGAAGGGCATCGTGAGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-879s1c1
Sequence:CCGGCGTATGTATTGTCTCATTGTTCTCGAGAACAATGAGACAATACATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-348s1c1
Sequence:CCGGTGATTGGTACAGCCATGATAACTCGAGTTATCATGGCTGTACCAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-407s1c1
Sequence:CCGGCCCTACTTACTGAAGTACTTTCTCGAGAAAGTACTTCAGTAAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-518s1c1
Sequence:CCGGTCGAAGCATGTGAAGCACGAACTCGAGTTCGTGCTTCACATGCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025450.1-374s1c1
Sequence:CCGGGCTAAAGTAAGAGCGACCAGACTCGAGTCTGGTCGCTCTTACTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025450
VALIDATED
MRPS17 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S17
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025450.4-806s21c1
Sequence:CCGGCTGAACTGAAGGTACTGATTACTCGAGTAATCAGTACCTTCAGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-597s21c1
Sequence:CCGGTGCAGGAACTGCCTACCTAGACTCGAGTCTAGGTAGGCAGTTCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025450.4-836s21c1
Sequence:CCGGCCTAAGGATGCGGCATCATTTCTCGAGAAATGATGCCGCATCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-510s21c1
Sequence:CCGGCCCACGATCGAAGCATGTGAACTCGAGTTCACATGCTTCGATCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-552s21c1
Sequence:CCGGCTTCAAAGTCGGCCGAGTTATCTCGAGATAACTCGGCCGACTTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-484s21c1
Sequence:CCGGATCGTGCTCCTCAGAGCTTTGCTCGAGCAAAGCTCTGAGGAGCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025450.4-444s21c1
Sequence:CCGGCTTTGCTCACGATGCCCTTCACTCGAGTGAAGGGCATCGTGAGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-879s1c1
Sequence:CCGGCGTATGTATTGTCTCATTGTTCTCGAGAACAATGAGACAATACATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-348s1c1
Sequence:CCGGTGATTGGTACAGCCATGATAACTCGAGTTATCATGGCTGTACCAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-407s1c1
Sequence:CCGGCCCTACTTACTGAAGTACTTTCTCGAGAAAGTACTTCAGTAAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025450.1-518s1c1
Sequence:CCGGTCGAAGCATGTGAAGCACGAACTCGAGTTCGTGCTTCACATGCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025450.1-374s1c1
Sequence:CCGGGCTAAAGTAAGAGCGACCAGACTCGAGTCTGGTCGCTCTTACTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015969
VALIDATED
MRPS17 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-233s1c1
Sequence:CCGGCTTTACCTGTTCCACGAGCAACTCGAGTTGCTCGTGGAACAGGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-104s1c1
Sequence:CCGGCTGCTAAAGTGAGAGTGACCACTCGAGTGGTCACTCTCACTTTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-244s1c1
Sequence:CCGGCCACGAGCAAAGCATGTGAAACTCGAGTTTCACATGCTTTGCTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-222s1c1
Sequence:CCGGGCTTCTCAGAGCTTTACCTGTCTCGAGACAGGTAAAGCTCTGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-367s1c1
Sequence:CCGGGAAACCACCCAGCTAAGCAAACTCGAGTTTGCTTAGCTGGGTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-261s1c1
Sequence:CCGGGAAACATGAACTGGCTGAGATCTCGAGATCTCAGCCAGTTCATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-250s1c1
Sequence:CCGGGCAAAGCATGTGAAACATGAACTCGAGTTCATGTTTCACATGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-434s1c1
Sequence:CCGGGAAGAAGGATCTAAAGGGAAACTCGAGTTTCCCTTTAGATCCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-397s1c1
Sequence:CCGGGAACTCAATATCTCTTCAGCACTCGAGTGCTGAAGAGATATTGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-394s1c1
Sequence:CCGGGAAGAACTCAATATCTCTTCACTCGAGTGAAGAGATATTGAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015969
VALIDATED
MRPS17 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-233s1c1
Sequence:CCGGCTTTACCTGTTCCACGAGCAACTCGAGTTGCTCGTGGAACAGGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-104s1c1
Sequence:CCGGCTGCTAAAGTGAGAGTGACCACTCGAGTGGTCACTCTCACTTTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-244s1c1
Sequence:CCGGCCACGAGCAAAGCATGTGAAACTCGAGTTTCACATGCTTTGCTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-222s1c1
Sequence:CCGGGCTTCTCAGAGCTTTACCTGTCTCGAGACAGGTAAAGCTCTGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-367s1c1
Sequence:CCGGGAAACCACCCAGCTAAGCAAACTCGAGTTTGCTTAGCTGGGTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-261s1c1
Sequence:CCGGGAAACATGAACTGGCTGAGATCTCGAGATCTCAGCCAGTTCATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-250s1c1
Sequence:CCGGGCAAAGCATGTGAAACATGAACTCGAGTTCATGTTTCACATGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-434s1c1
Sequence:CCGGGAAGAAGGATCTAAAGGGAAACTCGAGTTTCCCTTTAGATCCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-397s1c1
Sequence:CCGGGAACTCAATATCTCTTCAGCACTCGAGTGCTGAAGAGATATTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-394s1c1
Sequence:CCGGGAAGAACTCAATATCTCTTCACTCGAGTGAAGAGATATTGAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015969
VALIDATED
MRPS17 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-233s1c1
Sequence:CCGGCTTTACCTGTTCCACGAGCAACTCGAGTTGCTCGTGGAACAGGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-104s1c1
Sequence:CCGGCTGCTAAAGTGAGAGTGACCACTCGAGTGGTCACTCTCACTTTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-244s1c1
Sequence:CCGGCCACGAGCAAAGCATGTGAAACTCGAGTTTCACATGCTTTGCTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-222s1c1
Sequence:CCGGGCTTCTCAGAGCTTTACCTGTCTCGAGACAGGTAAAGCTCTGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-367s1c1
Sequence:CCGGGAAACCACCCAGCTAAGCAAACTCGAGTTTGCTTAGCTGGGTGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015969.2-261s1c1
Sequence:CCGGGAAACATGAACTGGCTGAGATCTCGAGATCTCAGCCAGTTCATGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-250s1c1
Sequence:CCGGGCAAAGCATGTGAAACATGAACTCGAGTTCATGTTTCACATGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-434s1c1
Sequence:CCGGGAAGAAGGATCTAAAGGGAAACTCGAGTTTCCCTTTAGATCCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-397s1c1
Sequence:CCGGGAACTCAATATCTCTTCAGCACTCGAGTGCTGAAGAGATATTGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015969.2-394s1c1
Sequence:CCGGGAAGAACTCAATATCTCTTCACTCGAGTGAAGAGATATTGAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)