EMAIL THIS PAGE TO A FRIEND

MRPS18A

mitochondrial ribosomal protein S18A

58 Gene Product Result for
Synonyms: HumanS18b MRP-S18-3 MRPS18-3 S18bmt
UniProtKB ID: Q9NVS2, A6XND3, Q5QPA4
Gene ID:
Human(55168) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. A pseudogene corresponding to this gene is found on chromosome 3p. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
Mouse(68565) mitochondrial ribosomal protein S18A
Rat(301249) mitochondrial ribosomal protein S18A
Zebrafish(558080) mitochondrial ribosomal protein S18A
fruit fly(326141) mitochondrial ribosomal protein S18A
cow(614102) mitochondrial ribosomal protein S18A
domestic cat(101089692) mitochondrial ribosomal protein S18A
dog(474917) mitochondrial ribosomal protein S18A
chicken(421445) mitochondrial ribosomal protein S18A
domestic guinea pig(100731034) mitochondrial ribosomal protein S18A
naked mole-rat(101707091) mitochondrial ribosomal protein S18A
sheep(101116355) mitochondrial ribosomal protein S18A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018135 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018135 Rosetta Predictions human pricing
NM_198756 Rosetta Predictions rat pricing
NM_026768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185118 predicted 378
2 SASI_Hs01_00185119 predicted 343
3 SASI_Hs01_00185120 predicted 731
4 SASI_Hs02_00351352 predicted 557
5 SASI_Hs01_00185121 predicted 409
6 SASI_Hs01_00185122 predicted 573
7 SASI_Hs01_00185123 predicted 658
8 SASI_Hs01_00185124 predicted 513
9 SASI_Hs01_00185125 predicted 612
10 SASI_Hs01_00185126 predicted 799
11 SASI_Hs01_00185127 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110873 predicted 528
2 SASI_Rn01_00110874 predicted 574
3 SASI_Rn01_00110875 predicted 409
4 SASI_Rn01_00110876 predicted 373
5 SASI_Rn01_00110877 predicted 604
6 SASI_Rn01_00110878 predicted 257
7 SASI_Rn01_00110879 predicted 231
8 SASI_Rn01_00110880 predicted 515
9 SASI_Rn01_00110881 predicted 472
10 SASI_Rn02_00269987 predicted 217
11 SASI_Rn01_00110882 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066894 predicted 254
2 SASI_Mm01_00066895 predicted 412
3 SASI_Mm01_00066897 predicted 388
4 SASI_Mm01_00066898 predicted 621
5 SASI_Mm01_00066899 predicted 483
6 SASI_Mm01_00066900 predicted 583
7 SASI_Mm01_00066901 predicted 510
8 SASI_Mm01_00066902 predicted 420
9 SASI_Mm02_00330834 predicted 414
10 SASI_Mm01_00066903 predicted 275
11 SASI_Mm01_00066896 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026768
VALIDATED
MRPS18A MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S18A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026768.1-628s1c1
Sequence:CCGGGCTGACTAGAACCGTCTAGAACTCGAGTTCTAGACGGTTCTAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-555s1c1
Sequence:CCGGCCTGAAAGACAATGTCTGCTACTCGAGTAGCAGACATTGTCTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-385s1c1
Sequence:CCGGCGAGCAGGTCTGTTACCAAATCTCGAGATTTGGTAACAGACCTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-250s1c1
Sequence:CCGGCACAAATATACCTATGAGGATCTCGAGATCCTCATAGGTATATTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-486s21c1
Sequence:CCGGTCCGTCAAGCCCATCTATAAACTCGAGTTTATAGATGGGCTTGACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-660s21c1
Sequence:CCGGCCTCCCACCAGAACCATTATCCTCGAGGATAATGGTTCTGGTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-152s1c1
Sequence:CCGGCGACTGTAATTGAAGGCCGAACTCGAGTTCGGCCTTCAATTACAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-554s21c1
Sequence:CCGGCCTGAAAGACAATGTCTGCTACTCGAGTAGCAGACATTGTCTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-584s21c1
Sequence:CCGGGCCTCTGAAGATGATGCATTACTCGAGTAATGCATCATCTTCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-282s21c1
Sequence:CCGGAGTCAGTTCATCCGGCCTTATCTCGAGATAAGGCCGGATGAACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026768
VALIDATED
MRPS18A MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S18A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026768.1-628s1c1
Sequence:CCGGGCTGACTAGAACCGTCTAGAACTCGAGTTCTAGACGGTTCTAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-555s1c1
Sequence:CCGGCCTGAAAGACAATGTCTGCTACTCGAGTAGCAGACATTGTCTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-385s1c1
Sequence:CCGGCGAGCAGGTCTGTTACCAAATCTCGAGATTTGGTAACAGACCTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-250s1c1
Sequence:CCGGCACAAATATACCTATGAGGATCTCGAGATCCTCATAGGTATATTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-486s21c1
Sequence:CCGGTCCGTCAAGCCCATCTATAAACTCGAGTTTATAGATGGGCTTGACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-660s21c1
Sequence:CCGGCCTCCCACCAGAACCATTATCCTCGAGGATAATGGTTCTGGTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-152s1c1
Sequence:CCGGCGACTGTAATTGAAGGCCGAACTCGAGTTCGGCCTTCAATTACAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-554s21c1
Sequence:CCGGCCTGAAAGACAATGTCTGCTACTCGAGTAGCAGACATTGTCTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-584s21c1
Sequence:CCGGGCCTCTGAAGATGATGCATTACTCGAGTAATGCATCATCTTCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-282s21c1
Sequence:CCGGAGTCAGTTCATCCGGCCTTATCTCGAGATAAGGCCGGATGAACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026768
VALIDATED
MRPS18A MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S18A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026768.1-628s1c1
Sequence:CCGGGCTGACTAGAACCGTCTAGAACTCGAGTTCTAGACGGTTCTAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-555s1c1
Sequence:CCGGCCTGAAAGACAATGTCTGCTACTCGAGTAGCAGACATTGTCTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-385s1c1
Sequence:CCGGCGAGCAGGTCTGTTACCAAATCTCGAGATTTGGTAACAGACCTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-250s1c1
Sequence:CCGGCACAAATATACCTATGAGGATCTCGAGATCCTCATAGGTATATTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-486s21c1
Sequence:CCGGTCCGTCAAGCCCATCTATAAACTCGAGTTTATAGATGGGCTTGACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-660s21c1
Sequence:CCGGCCTCCCACCAGAACCATTATCCTCGAGGATAATGGTTCTGGTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026768.1-152s1c1
Sequence:CCGGCGACTGTAATTGAAGGCCGAACTCGAGTTCGGCCTTCAATTACAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-554s21c1
Sequence:CCGGCCTGAAAGACAATGTCTGCTACTCGAGTAGCAGACATTGTCTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-584s21c1
Sequence:CCGGGCCTCTGAAGATGATGCATTACTCGAGTAATGCATCATCTTCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026768.3-282s21c1
Sequence:CCGGAGTCAGTTCATCCGGCCTTATCTCGAGATAAGGCCGGATGAACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018135
VALIDATED
MRPS18A MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S18A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-876s1c1
Sequence:CCGGCCCAACGCAGTGTCATAAACTCTCGAGAGTTTATGACACTGCGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-242s21c1
Sequence:CCGGTGAAGCACAAGTATAACTATGCTCGAGCATAGTTATACTTGTGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-382s21c1
Sequence:CCGGCGAGCAGGTCTATTACCAAATCTCGAGATTTGGTAATAGACCTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-139s21c1
Sequence:CCGGGAAGGGAAGACAACTATAATTCTCGAGAATTATAGTTGTCTTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-237s1c1
Sequence:CCGGGAACCTGAAGCACAAGTATAACTCGAGTTATACTTGTGCTTCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-246s1c1
Sequence:CCGGGCACAAGTATAACTATGACGACTCGAGTCGTCATAGTTATACTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018135.2-136s1c1
Sequence:CCGGCAAGAAGGGAAGACAACTATACTCGAGTATAGTTGTCTTCCCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018135.2-881s1c1
Sequence:CCGGCGCAGTGTCATAAACTGGGTTCTCGAGAACCCAGTTTATGACACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-484s21c1
Sequence:CCGGTCCGTCAAGCCCATCTACAAACTCGAGTTTGTAGATGGGCTTGACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-766s21c1
Sequence:CCGGTTGGCCTGCACAGTAGCAATGCTCGAGCATTGCTACTGTGCAGGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018135
VALIDATED
MRPS18A MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S18A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-876s1c1
Sequence:CCGGCCCAACGCAGTGTCATAAACTCTCGAGAGTTTATGACACTGCGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-242s21c1
Sequence:CCGGTGAAGCACAAGTATAACTATGCTCGAGCATAGTTATACTTGTGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-382s21c1
Sequence:CCGGCGAGCAGGTCTATTACCAAATCTCGAGATTTGGTAATAGACCTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-139s21c1
Sequence:CCGGGAAGGGAAGACAACTATAATTCTCGAGAATTATAGTTGTCTTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-237s1c1
Sequence:CCGGGAACCTGAAGCACAAGTATAACTCGAGTTATACTTGTGCTTCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-246s1c1
Sequence:CCGGGCACAAGTATAACTATGACGACTCGAGTCGTCATAGTTATACTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018135.2-136s1c1
Sequence:CCGGCAAGAAGGGAAGACAACTATACTCGAGTATAGTTGTCTTCCCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018135.2-881s1c1
Sequence:CCGGCGCAGTGTCATAAACTGGGTTCTCGAGAACCCAGTTTATGACACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-484s21c1
Sequence:CCGGTCCGTCAAGCCCATCTACAAACTCGAGTTTGTAGATGGGCTTGACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-766s21c1
Sequence:CCGGTTGGCCTGCACAGTAGCAATGCTCGAGCATTGCTACTGTGCAGGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018135
VALIDATED
MRPS18A MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S18A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-876s1c1
Sequence:CCGGCCCAACGCAGTGTCATAAACTCTCGAGAGTTTATGACACTGCGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-242s21c1
Sequence:CCGGTGAAGCACAAGTATAACTATGCTCGAGCATAGTTATACTTGTGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-382s21c1
Sequence:CCGGCGAGCAGGTCTATTACCAAATCTCGAGATTTGGTAATAGACCTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-139s21c1
Sequence:CCGGGAAGGGAAGACAACTATAATTCTCGAGAATTATAGTTGTCTTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-237s1c1
Sequence:CCGGGAACCTGAAGCACAAGTATAACTCGAGTTATACTTGTGCTTCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018135.2-246s1c1
Sequence:CCGGGCACAAGTATAACTATGACGACTCGAGTCGTCATAGTTATACTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018135.2-136s1c1
Sequence:CCGGCAAGAAGGGAAGACAACTATACTCGAGTATAGTTGTCTTCCCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018135.2-881s1c1
Sequence:CCGGCGCAGTGTCATAAACTGGGTTCTCGAGAACCCAGTTTATGACACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-484s21c1
Sequence:CCGGTCCGTCAAGCCCATCTACAAACTCGAGTTTGTAGATGGGCTTGACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018135.2-766s21c1
Sequence:CCGGTTGGCCTGCACAGTAGCAATGCTCGAGCATTGCTACTGTGCAGGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)