EMAIL THIS PAGE TO A FRIEND

MRPS18B

mitochondrial ribosomal protein S18B

65 Gene Product Result for
Synonyms: C6orf14 HSPC183 HumanS18a MRP-S18-2 MRPS18-2 PTD017 S18amt
UniProtKB ID: Q9Y676, A6NDQ0, Q659G4, Q9BS27
Gene ID:
Human(28973) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Jul 2008]
Mouse(66973) mitochondrial ribosomal protein S18B
Rat(294230) mitochondrial ribosomal protein S18B
Zebrafish(550455) mitochondrial ribosomal protein S18B
cow(510824) mitochondrial ribosomal protein S18B
domestic cat(101093104) mitochondrial ribosomal protein S18B
dog(474827) mitochondrial ribosomal protein S18B
fruit fly(35299) mitochondrial ribosomal protein S18B
sheep(101107394) mitochondrial ribosomal protein S18B
naked mole-rat(101708525) mitochondrial ribosomal protein S18B
domestic guinea pig(100722297) mitochondrial ribosomal protein S18B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110381 MISSION® esiRNA esiRNA human AL732442.7-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014046 Rosetta Predictions human pricing
NM_212534 Rosetta Predictions rat pricing
NM_025878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208383 predicted 318
2 SASI_Hs01_00208384 predicted 507
3 SASI_Hs01_00208385 predicted 378
4 SASI_Hs02_00345043 predicted 268
5 SASI_Hs01_00208388 predicted 430
6 SASI_Hs02_00345044 predicted 198
7 SASI_Hs01_00208390 predicted 554
8 SASI_Hs02_00345045 predicted 253
9 SASI_Hs01_00208391 predicted 482
10 SASI_Hs02_00345046 predicted 307
11 SASI_Hs01_00208386 predicted 363
12 SASI_Hs01_00208387 predicted 506
13 SASI_Hs01_00208389 predicted 303
14 SASI_Hs01_00208392 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270556 predicted 463
2 SASI_Rn01_00060803 predicted 263
3 SASI_Rn01_00060804 predicted 209
4 SASI_Rn01_00060805 predicted 320
5 SASI_Rn01_00060806 predicted 563
6 SASI_Rn01_00060807 predicted 747
7 SASI_Rn01_00060808 predicted 324
8 SASI_Rn01_00060809 predicted 325
9 SASI_Rn01_00060810 predicted 583
10 SASI_Rn01_00060811 predicted 457
11 SASI_Rn01_00060802 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162975 predicted 307
2 SASI_Mm01_00162976 predicted 222
3 SASI_Mm01_00162977 predicted 372
4 SASI_Mm01_00162980 predicted 350
5 SASI_Mm01_00162981 predicted 268
6 SASI_Mm01_00162983 predicted 328
7 SASI_Mm01_00162984 predicted 378
8 SASI_Mm02_00329204 predicted 252
9 SASI_Mm02_00329205 predicted 351
10 SASI_Mm01_00162978 predicted 711
11 SASI_Mm01_00162979 predicted 810
12 SASI_Mm01_00162982 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014046
VALIDATED
MRPS18B MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S18B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-446s21c1
Sequence:CCGGCGGAATAAAGTTGTTGGGAATCTCGAGATTCCCAACAACTTTATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-630s21c1
Sequence:CCGGGGGATCATGGTCTCCTCATTTCTCGAGAAATGAGGAGACCATGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-1108s21c1
Sequence:CCGGGCACACCTGTAGTCTCAACTACTCGAGTAGTTGAGACTACAGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014046.2-988s1c1
Sequence:CCGGGCACACCTGTAGTCTCAACTACTCGAGTAGTTGAGACTACAGGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-221s1c1
Sequence:CCGGGAAGAATACCAGGAGCGATATCTCGAGATATCGCTCCTGGTATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014046.2-1232s1c1
Sequence:CCGGCAGGAAATGAATGTTGCTGATCTCGAGATCAGCAACATTCATTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-155s1c1
Sequence:CCGGGAAGATTCTTTGTCCTCAGTTCTCGAGAACTGAGGACAAAGAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-326s1c1
Sequence:CCGGCGGAATAAAGTTGTTGGGAATCTCGAGATTCCCAACAACTTTATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-376s1c1
Sequence:CCGGGCATGTTGACTTTAGGAACGTCTCGAGACGTTCCTAAAGTCAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-362s1c1
Sequence:CCGGCGAGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-422s21c1
Sequence:CCGGCGGACTCGGAAGACATGTATTCTCGAGAATACATGTCTTCCGAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014046
VALIDATED
MRPS18B MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S18B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-446s21c1
Sequence:CCGGCGGAATAAAGTTGTTGGGAATCTCGAGATTCCCAACAACTTTATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-630s21c1
Sequence:CCGGGGGATCATGGTCTCCTCATTTCTCGAGAAATGAGGAGACCATGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-1108s21c1
Sequence:CCGGGCACACCTGTAGTCTCAACTACTCGAGTAGTTGAGACTACAGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014046.2-988s1c1
Sequence:CCGGGCACACCTGTAGTCTCAACTACTCGAGTAGTTGAGACTACAGGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-221s1c1
Sequence:CCGGGAAGAATACCAGGAGCGATATCTCGAGATATCGCTCCTGGTATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014046.2-1232s1c1
Sequence:CCGGCAGGAAATGAATGTTGCTGATCTCGAGATCAGCAACATTCATTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-155s1c1
Sequence:CCGGGAAGATTCTTTGTCCTCAGTTCTCGAGAACTGAGGACAAAGAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-326s1c1
Sequence:CCGGCGGAATAAAGTTGTTGGGAATCTCGAGATTCCCAACAACTTTATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-376s1c1
Sequence:CCGGGCATGTTGACTTTAGGAACGTCTCGAGACGTTCCTAAAGTCAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-362s1c1
Sequence:CCGGCGAGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-422s21c1
Sequence:CCGGCGGACTCGGAAGACATGTATTCTCGAGAATACATGTCTTCCGAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014046
VALIDATED
MRPS18B MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S18B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-446s21c1
Sequence:CCGGCGGAATAAAGTTGTTGGGAATCTCGAGATTCCCAACAACTTTATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-630s21c1
Sequence:CCGGGGGATCATGGTCTCCTCATTTCTCGAGAAATGAGGAGACCATGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-1108s21c1
Sequence:CCGGGCACACCTGTAGTCTCAACTACTCGAGTAGTTGAGACTACAGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014046.2-988s1c1
Sequence:CCGGGCACACCTGTAGTCTCAACTACTCGAGTAGTTGAGACTACAGGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-221s1c1
Sequence:CCGGGAAGAATACCAGGAGCGATATCTCGAGATATCGCTCCTGGTATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014046.2-1232s1c1
Sequence:CCGGCAGGAAATGAATGTTGCTGATCTCGAGATCAGCAACATTCATTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-155s1c1
Sequence:CCGGGAAGATTCTTTGTCCTCAGTTCTCGAGAACTGAGGACAAAGAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-326s1c1
Sequence:CCGGCGGAATAAAGTTGTTGGGAATCTCGAGATTCCCAACAACTTTATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-376s1c1
Sequence:CCGGGCATGTTGACTTTAGGAACGTCTCGAGACGTTCCTAAAGTCAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014046.2-362s1c1
Sequence:CCGGCGAGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014046.3-422s21c1
Sequence:CCGGCGGACTCGGAAGACATGTATTCTCGAGAATACATGTCTTCCGAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025878
VALIDATED
MRPS18B MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S18B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025878.1-649s21c1
Sequence:CCGGCGCCGACTCTATCAAGGAAATCTCGAGATTTCCTTGATAGAGTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-325s21c1
Sequence:CCGGCGGGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-889s21c1
Sequence:CCGGCATGAAGAGAACAAAGCACATCTCGAGATGTGCTTTGTTCTCTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-336s21c1
Sequence:CCGGGTTGCATGTTGACTTTAGGAACTCGAGTTCCTAAAGTCAACATGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-325s1c1
Sequence:CCGGCGGGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-265s1c1
Sequence:CCGGCGGACCCGAAAGACATGTATTCTCGAGAATACATGTCTTTCGGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-649s1c1
Sequence:CCGGCGCCGACTCTATCAAGGAAATCTCGAGATTTCCTTGATAGAGTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-889s1c1
Sequence:CCGGCATGAAGAGAACAAAGCACATCTCGAGATGTGCTTTGTTCTCTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-265s21c1
Sequence:CCGGCGGACCCGAAAGACATGTATTCTCGAGAATACATGTCTTTCGGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-336s1c1
Sequence:CCGGGTTGCATGTTGACTTTAGGAACTCGAGTTCCTAAAGTCAACATGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025878
VALIDATED
MRPS18B MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S18B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025878.1-649s21c1
Sequence:CCGGCGCCGACTCTATCAAGGAAATCTCGAGATTTCCTTGATAGAGTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-325s21c1
Sequence:CCGGCGGGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-889s21c1
Sequence:CCGGCATGAAGAGAACAAAGCACATCTCGAGATGTGCTTTGTTCTCTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-336s21c1
Sequence:CCGGGTTGCATGTTGACTTTAGGAACTCGAGTTCCTAAAGTCAACATGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-325s1c1
Sequence:CCGGCGGGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-265s1c1
Sequence:CCGGCGGACCCGAAAGACATGTATTCTCGAGAATACATGTCTTTCGGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-649s1c1
Sequence:CCGGCGCCGACTCTATCAAGGAAATCTCGAGATTTCCTTGATAGAGTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-889s1c1
Sequence:CCGGCATGAAGAGAACAAAGCACATCTCGAGATGTGCTTTGTTCTCTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-265s21c1
Sequence:CCGGCGGACCCGAAAGACATGTATTCTCGAGAATACATGTCTTTCGGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-336s1c1
Sequence:CCGGGTTGCATGTTGACTTTAGGAACTCGAGTTCCTAAAGTCAACATGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025878
VALIDATED
MRPS18B MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S18B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025878.1-649s21c1
Sequence:CCGGCGCCGACTCTATCAAGGAAATCTCGAGATTTCCTTGATAGAGTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-325s21c1
Sequence:CCGGCGGGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-889s21c1
Sequence:CCGGCATGAAGAGAACAAAGCACATCTCGAGATGTGCTTTGTTCTCTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-336s21c1
Sequence:CCGGGTTGCATGTTGACTTTAGGAACTCGAGTTCCTAAAGTCAACATGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-325s1c1
Sequence:CCGGCGGGATCACAAGTTGCATGTTCTCGAGAACATGCAACTTGTGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-265s1c1
Sequence:CCGGCGGACCCGAAAGACATGTATTCTCGAGAATACATGTCTTTCGGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-649s1c1
Sequence:CCGGCGCCGACTCTATCAAGGAAATCTCGAGATTTCCTTGATAGAGTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-889s1c1
Sequence:CCGGCATGAAGAGAACAAAGCACATCTCGAGATGTGCTTTGTTCTCTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025878.1-265s21c1
Sequence:CCGGCGGACCCGAAAGACATGTATTCTCGAGAATACATGTCTTTCGGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025878.1-336s1c1
Sequence:CCGGGTTGCATGTTGACTTTAGGAACTCGAGTTCCTAAAGTCAACATGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)