EMAIL THIS PAGE TO A FRIEND

MRPS21

mitochondrial ribosomal protein S21

66 Gene Product Result for
Synonyms: MRP-S21 RPMS21
UniProtKB ID: P82921, Q5TB11, Q9BST6
Gene ID:
Human(54460) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S21P family. Pseudogenes corresponding to this gene are found on chromosomes 1p, 1q, 9p, 10p, 10q, 16q, and 17q. Available sequence data analyses identified splice variants that differ in the 5' UTR; both transcripts encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(66292) mitochondrial ribosomal protein S21
Rat(689432) mitochondrial ribosomal protein S21
domestic guinea pig(100730513) mitochondrial ribosomal protein S21
naked mole-rat(101719855) mitochondrial ribosomal protein S21
sheep(101104105) mitochondrial ribosomal protein S21
Zebrafish(100073334) mitochondrial ribosomal protein S21
cow(614343) mitochondrial ribosomal protein S21
domestic cat(101084128) mitochondrial ribosomal protein S21
dog(607977) mitochondrial ribosomal protein S21
chicken(426666) mitochondrial ribosomal protein S21
fruit fly(318249) mitochondrial ribosomal protein S21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018997 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_078479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_078479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_078479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093131 MISSION® esiRNA esiRNA targeting mouse Mrps21 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018997 Rosetta Predictions human pricing
NM_031901 Rosetta Predictions human pricing
NM_001126094 Rosetta Predictions rat pricing
NM_078479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229289 predicted 627
2 SASI_Hs02_00352504 predicted 628
3 SASI_Hs01_00229285 predicted 574
4 SASI_Hs01_00229287 predicted 613
5 SASI_Hs01_00229288 predicted 604
6 SASI_Hs01_00229290 predicted 572
7 SASI_Hs01_00229292 predicted 596
8 SASI_Hs02_00352505 predicted 717
9 SASI_Hs01_00229294 predicted 574
10 SASI_Hs02_00352506 predicted 703
11 SASI_Hs01_00229286 predicted 634
12 SASI_Hs01_00229291 predicted 704
13 SASI_Hs01_00229293 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141268 predicted 197
2 SASI_Hs02_00359022 predicted 255
3 SASI_Hs02_00359023 predicted 275
4 SASI_Hs01_00141270 predicted 202
5 SASI_Hs02_00359024 predicted 254
6 SASI_Hs02_00359025 predicted 285
7 SASI_Hs01_00141271 predicted 233
8 SASI_Hs01_00141272 predicted 194
9 SASI_Hs01_00141274 predicted 236
10 SASI_Hs01_00141275 predicted 196
11 SASI_Hs01_00141269 predicted 239
12 SASI_Hs01_00141273 predicted 233
13 SASI_Hs01_00141276 predicted 228
14 SASI_Hs01_00141277 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252953 predicted 319
2 SASI_Rn02_00252954 predicted 316
3 SASI_Rn02_00252955 predicted 315
4 SASI_Rn02_00252956 predicted 380
5 SASI_Rn02_00252957 predicted 339
6 SASI_Rn02_00252958 predicted 379
7 SASI_Rn02_00252959 predicted 319
8 SASI_Rn02_00252960 predicted 327
9 SASI_Rn02_00252961 predicted 319
10 SASI_Rn02_00252962 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185905 predicted 248
2 SASI_Mm02_00338072 predicted 256
3 SASI_Mm02_00338073 predicted 138
4 SASI_Mm01_00185906 predicted 219
5 SASI_Mm01_00185907 predicted 222
6 SASI_Mm01_00185908 predicted 355
7 SASI_Mm01_00185909 predicted 136
8 SASI_Mm01_00185910 predicted 326
9 SASI_Mm01_00185911 predicted 335
10 SASI_Mm01_00185912 predicted 41
11 SASI_Mm01_00185913 predicted 232
12 SASI_Mm01_00185914 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018997
VALIDATED
MRPS21 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-633s21c1
Sequence:CCGGATTAAGCATCGGCGGTATTATCTCGAGATAATACCGCCGATGCTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018997.2-569s21c1
Sequence:CCGGGAACGTGGAAAGCGCATACAGCTCGAGCTGTATGCGCTTTCCACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-593s1c1
Sequence:CCGGCCTAAACAGAATCCTCACTATCTCGAGATAGTGAGGATTCTGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018997.1-546s1c1
Sequence:CCGGAGGACTGTGATGGTACAGGAACTCGAGTTCCTGTACCATCACAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-630s1c1
Sequence:CCGGGACATTAAGCATCGGCGGTATCTCGAGATACCGCCGATGCTTAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018997.1-731s1c1
Sequence:CCGGGATCAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-699s1c1
Sequence:CCGGCGGCGGATCTACAACATGGAACTCGAGTTCCATGTTGTAGATCCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-701s21c1
Sequence:CCGGGCGGATCTACAACATGGAAATCTCGAGATTTCCATGTTGTAGATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-731s21c1
Sequence:CCGGGATCAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018997.2-744s21c1
Sequence:CCGGATGCGAAAGAATCGGGCAGATCTCGAGATCTGCCCGATTCTTTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018997
VALIDATED
MRPS21 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-633s21c1
Sequence:CCGGATTAAGCATCGGCGGTATTATCTCGAGATAATACCGCCGATGCTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018997.2-569s21c1
Sequence:CCGGGAACGTGGAAAGCGCATACAGCTCGAGCTGTATGCGCTTTCCACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-593s1c1
Sequence:CCGGCCTAAACAGAATCCTCACTATCTCGAGATAGTGAGGATTCTGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018997.1-546s1c1
Sequence:CCGGAGGACTGTGATGGTACAGGAACTCGAGTTCCTGTACCATCACAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-630s1c1
Sequence:CCGGGACATTAAGCATCGGCGGTATCTCGAGATACCGCCGATGCTTAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018997.1-731s1c1
Sequence:CCGGGATCAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-699s1c1
Sequence:CCGGCGGCGGATCTACAACATGGAACTCGAGTTCCATGTTGTAGATCCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-701s21c1
Sequence:CCGGGCGGATCTACAACATGGAAATCTCGAGATTTCCATGTTGTAGATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-731s21c1
Sequence:CCGGGATCAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018997.2-744s21c1
Sequence:CCGGATGCGAAAGAATCGGGCAGATCTCGAGATCTGCCCGATTCTTTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018997
VALIDATED
MRPS21 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-633s21c1
Sequence:CCGGATTAAGCATCGGCGGTATTATCTCGAGATAATACCGCCGATGCTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018997.2-569s21c1
Sequence:CCGGGAACGTGGAAAGCGCATACAGCTCGAGCTGTATGCGCTTTCCACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-593s1c1
Sequence:CCGGCCTAAACAGAATCCTCACTATCTCGAGATAGTGAGGATTCTGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018997.1-546s1c1
Sequence:CCGGAGGACTGTGATGGTACAGGAACTCGAGTTCCTGTACCATCACAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-630s1c1
Sequence:CCGGGACATTAAGCATCGGCGGTATCTCGAGATACCGCCGATGCTTAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018997.1-731s1c1
Sequence:CCGGGATCAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018997.1-699s1c1
Sequence:CCGGCGGCGGATCTACAACATGGAACTCGAGTTCCATGTTGTAGATCCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-701s21c1
Sequence:CCGGGCGGATCTACAACATGGAAATCTCGAGATTTCCATGTTGTAGATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018997.2-731s21c1
Sequence:CCGGGATCAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018997.2-744s21c1
Sequence:CCGGATGCGAAAGAATCGGGCAGATCTCGAGATCTGCCCGATTCTTTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078479
VALIDATED
MRPS21 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S21
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-242s1c1
Sequence:CCGGCATGGAAATGGCTCGAAAGATCTCGAGATCTTTCGAGCCATTTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-113s21c1
Sequence:CCGGCTACCGGACCCTGAACAGAATCTCGAGATTCTGTTCAGGGTCCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-148s21c1
Sequence:CCGGGGCTTACCGAAGTCATAAGTCCTCGAGGACTTATGACTTCGGTAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078479.2-172s21c1
Sequence:CCGGGACGCTACTATGAGAAGCCTTCTCGAGAAGGCTTCTCATAGTAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-144s1c1
Sequence:CCGGGATGGGCTTACCGAAGTCATACTCGAGTATGACTTCGGTAAGCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-260s1c1
Sequence:CCGGGATTAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-222s21c1
Sequence:CCGGACATGCCGGAGGATCTACAACCTCGAGGTTGTAGATCCTCCGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-244s21c1
Sequence:CCGGTGGAAATGGCTCGAAAGATTACTCGAGTAATCTTTCGAGCCATTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078479
VALIDATED
MRPS21 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S21
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-242s1c1
Sequence:CCGGCATGGAAATGGCTCGAAAGATCTCGAGATCTTTCGAGCCATTTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-113s21c1
Sequence:CCGGCTACCGGACCCTGAACAGAATCTCGAGATTCTGTTCAGGGTCCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-148s21c1
Sequence:CCGGGGCTTACCGAAGTCATAAGTCCTCGAGGACTTATGACTTCGGTAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078479.2-172s21c1
Sequence:CCGGGACGCTACTATGAGAAGCCTTCTCGAGAAGGCTTCTCATAGTAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-144s1c1
Sequence:CCGGGATGGGCTTACCGAAGTCATACTCGAGTATGACTTCGGTAAGCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-260s1c1
Sequence:CCGGGATTAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-222s21c1
Sequence:CCGGACATGCCGGAGGATCTACAACCTCGAGGTTGTAGATCCTCCGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-244s21c1
Sequence:CCGGTGGAAATGGCTCGAAAGATTACTCGAGTAATCTTTCGAGCCATTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078479
VALIDATED
MRPS21 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S21
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-242s1c1
Sequence:CCGGCATGGAAATGGCTCGAAAGATCTCGAGATCTTTCGAGCCATTTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-113s21c1
Sequence:CCGGCTACCGGACCCTGAACAGAATCTCGAGATTCTGTTCAGGGTCCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-148s21c1
Sequence:CCGGGGCTTACCGAAGTCATAAGTCCTCGAGGACTTATGACTTCGGTAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078479.2-172s21c1
Sequence:CCGGGACGCTACTATGAGAAGCCTTCTCGAGAAGGCTTCTCATAGTAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-144s1c1
Sequence:CCGGGATGGGCTTACCGAAGTCATACTCGAGTATGACTTCGGTAAGCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078479.2-260s1c1
Sequence:CCGGGATTAACTTCTTGATGCGAAACTCGAGTTTCGCATCAAGAAGTTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-222s21c1
Sequence:CCGGACATGCCGGAGGATCTACAACCTCGAGGTTGTAGATCCTCCGGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_078479.2-244s21c1
Sequence:CCGGTGGAAATGGCTCGAAAGATTACTCGAGTAATCTTTCGAGCCATTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)