EMAIL THIS PAGE TO A FRIEND

MRPS22

mitochondrial ribosomal protein S22

46 Gene Product Result for
Synonyms: C3orf5 COXPD5 GIBT MRP-S22 RPMS22
UniProtKB ID: P82650
Gene ID:
Human(56945) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that does not seem to have a counterpart in prokaryotic and fungal-mitochondrial ribosomes. This gene lies telomeric of and is transcribed in the opposite direction from the forkhead box L2 gene. A pseudogene corresponding to this gene is found on chromosome Xq. [provided by RefSeq, Jul 2008]
Mouse(64655) mitochondrial ribosomal protein S22
Rat(683519) mitochondrial ribosomal protein S22
Zebrafish(556778) mitochondrial ribosomal protein S22
cow(532044) mitochondrial ribosomal protein S22
domestic cat(101091392) mitochondrial ribosomal protein S22
dog(477924) 28S ribosomal protein S22, mitochondrial-like
dog(609331) mitochondrial ribosomal protein S22
chicken(424824) mitochondrial ribosomal protein S22
fruit fly(43345) mitochondrial ribosomal protein S22
domestic guinea pig(100733062) mitochondrial ribosomal protein S22
naked mole-rat(101716512) mitochondrial ribosomal protein S22
sheep(101109502) mitochondrial ribosomal protein S22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020191 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020191 Rosetta Predictions human pricing
NM_001077530 Rosetta Predictions rat pricing
NM_025485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173536 predicted 467
2 SASI_Hs01_00173537 predicted 427
3 SASI_Hs01_00173538 predicted 707
4 SASI_Hs01_00173539 predicted 841
5 SASI_Hs01_00173541 predicted 456
6 SASI_Hs01_00173542 predicted 525
7 SASI_Hs01_00173543 predicted 754
8 SASI_Hs01_00173544 predicted 853
9 SASI_Hs01_00173545 predicted 257
10 SASI_Hs02_00353111 predicted 206
11 SASI_Hs01_00173540 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207572 predicted 290
2 SASI_Rn02_00207573 predicted 406
3 SASI_Rn02_00207574 predicted 452
4 SASI_Rn02_00207575 predicted 698
5 SASI_Rn02_00207576 predicted 704
6 SASI_Rn02_00207577 predicted 467
7 SASI_Rn02_00207578 predicted 801
8 SASI_Rn02_00207579 predicted 748
9 SASI_Rn02_00207580 predicted 589
10 SASI_Rn02_00207581 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170387 predicted 463
2 SASI_Mm01_00170388 predicted 422
3 SASI_Mm01_00170389 predicted 370
4 SASI_Mm01_00170390 predicted 417
5 SASI_Mm01_00170391 predicted 561
6 SASI_Mm01_00170392 predicted 397
7 SASI_Mm01_00170393 predicted 213
8 SASI_Mm01_00170394 predicted 406
9 SASI_Mm01_00170395 predicted 333
10 SASI_Mm02_00328356 predicted 292
11 SASI_Mm01_00170386 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020191
MRPS22 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S22
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-259s21c1
Sequence:CCGGGCTTGAACTTGCAGAAGACTTCTCGAGAAGTCTTCTGCAAGTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-408s21c1
Sequence:CCGGGAGCGAGTACCAATAAATGATCTCGAGATCATTTATTGGTACTCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-125s21c1
Sequence:CCGGGCTACCTTGCTCTTTCGAGATCTCGAGATCTCGAAAGAGCAAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-259s1c1
Sequence:CCGGGCTTGAACTTGCAGAAGACTTCTCGAGAAGTCTTCTGCAAGTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-366s1c1
Sequence:CCGGGAGGCAGCTAAAGTACGATTACTCGAGTAATCGTACTTTAGCTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-795s1c1
Sequence:CCGGCGTTCAACAAGATACTTTGGTCTCGAGACCAAAGTATCTTGTTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-210s1c1
Sequence:CCGGCCTACATTTATGGATGAGGAACTCGAGTTCCTCATCCATAAATGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-453s1c1
Sequence:CCGGGAAGGAACAGAAACAACCAAACTCGAGTTTGGTTGTTTCTGTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-795s21c1
Sequence:CCGGCGTTCAACAAGATACTTTGGTCTCGAGACCAAAGTATCTTGTTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-408s1c1
Sequence:CCGGGAGCGAGTACCAATAAATGATCTCGAGATCATTTATTGGTACTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-125s1c1
Sequence:CCGGGCTACCTTGCTCTTTCGAGATCTCGAGATCTCGAAAGAGCAAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020191
MRPS22 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S22
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-259s21c1
Sequence:CCGGGCTTGAACTTGCAGAAGACTTCTCGAGAAGTCTTCTGCAAGTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-408s21c1
Sequence:CCGGGAGCGAGTACCAATAAATGATCTCGAGATCATTTATTGGTACTCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-125s21c1
Sequence:CCGGGCTACCTTGCTCTTTCGAGATCTCGAGATCTCGAAAGAGCAAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-259s1c1
Sequence:CCGGGCTTGAACTTGCAGAAGACTTCTCGAGAAGTCTTCTGCAAGTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-366s1c1
Sequence:CCGGGAGGCAGCTAAAGTACGATTACTCGAGTAATCGTACTTTAGCTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-795s1c1
Sequence:CCGGCGTTCAACAAGATACTTTGGTCTCGAGACCAAAGTATCTTGTTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-210s1c1
Sequence:CCGGCCTACATTTATGGATGAGGAACTCGAGTTCCTCATCCATAAATGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-453s1c1
Sequence:CCGGGAAGGAACAGAAACAACCAAACTCGAGTTTGGTTGTTTCTGTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-795s21c1
Sequence:CCGGCGTTCAACAAGATACTTTGGTCTCGAGACCAAAGTATCTTGTTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-408s1c1
Sequence:CCGGGAGCGAGTACCAATAAATGATCTCGAGATCATTTATTGGTACTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-125s1c1
Sequence:CCGGGCTACCTTGCTCTTTCGAGATCTCGAGATCTCGAAAGAGCAAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020191
MRPS22 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S22
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-259s21c1
Sequence:CCGGGCTTGAACTTGCAGAAGACTTCTCGAGAAGTCTTCTGCAAGTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-408s21c1
Sequence:CCGGGAGCGAGTACCAATAAATGATCTCGAGATCATTTATTGGTACTCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-125s21c1
Sequence:CCGGGCTACCTTGCTCTTTCGAGATCTCGAGATCTCGAAAGAGCAAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-259s1c1
Sequence:CCGGGCTTGAACTTGCAGAAGACTTCTCGAGAAGTCTTCTGCAAGTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-366s1c1
Sequence:CCGGGAGGCAGCTAAAGTACGATTACTCGAGTAATCGTACTTTAGCTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-795s1c1
Sequence:CCGGCGTTCAACAAGATACTTTGGTCTCGAGACCAAAGTATCTTGTTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-210s1c1
Sequence:CCGGCCTACATTTATGGATGAGGAACTCGAGTTCCTCATCCATAAATGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-453s1c1
Sequence:CCGGGAAGGAACAGAAACAACCAAACTCGAGTTTGGTTGTTTCTGTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020191.2-795s21c1
Sequence:CCGGCGTTCAACAAGATACTTTGGTCTCGAGACCAAAGTATCTTGTTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-408s1c1
Sequence:CCGGGAGCGAGTACCAATAAATGATCTCGAGATCATTTATTGGTACTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020191.2-125s1c1
Sequence:CCGGGCTACCTTGCTCTTTCGAGATCTCGAGATCTCGAAAGAGCAAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025485
VALIDATED
MRPS22 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S22
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-731s1c1
Sequence:CCGGGCTGAGTATATCAAGGTTCATCTCGAGATGAACCTTGATATACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-975s21c1
Sequence:CCGGTGCTGAGGGAGTCGACTTAATCTCGAGATTAAGTCGACTCCCTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-721s21c1
Sequence:CCGGCCAGATTCCGCTGAGTATATCCTCGAGGATATACTCAGCGGAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-419s21c1
Sequence:CCGGAGCCAATAAATGACGTATTAGCTCGAGCTAATACGTCATTTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-307s1c1
Sequence:CCGGGAAGCCACCAACCTATAAGTTCTCGAGAACTTATAGGTTGGTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-386s1c1
Sequence:CCGGCGATTAAAGATGCCACCAGTTCTCGAGAACTGGTGGCATCTTTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-303s21c1
Sequence:CCGGACTGAAGCCACCAACCTATAACTCGAGTTATAGGTTGGTGGCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-1017s21c1
Sequence:CCGGAGCACAGAGAGGAGCATATATCTCGAGATATATGCTCCTCTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025485
VALIDATED
MRPS22 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S22
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-731s1c1
Sequence:CCGGGCTGAGTATATCAAGGTTCATCTCGAGATGAACCTTGATATACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-975s21c1
Sequence:CCGGTGCTGAGGGAGTCGACTTAATCTCGAGATTAAGTCGACTCCCTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-721s21c1
Sequence:CCGGCCAGATTCCGCTGAGTATATCCTCGAGGATATACTCAGCGGAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-419s21c1
Sequence:CCGGAGCCAATAAATGACGTATTAGCTCGAGCTAATACGTCATTTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-307s1c1
Sequence:CCGGGAAGCCACCAACCTATAAGTTCTCGAGAACTTATAGGTTGGTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-386s1c1
Sequence:CCGGCGATTAAAGATGCCACCAGTTCTCGAGAACTGGTGGCATCTTTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-303s21c1
Sequence:CCGGACTGAAGCCACCAACCTATAACTCGAGTTATAGGTTGGTGGCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-1017s21c1
Sequence:CCGGAGCACAGAGAGGAGCATATATCTCGAGATATATGCTCCTCTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025485
VALIDATED
MRPS22 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S22
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-731s1c1
Sequence:CCGGGCTGAGTATATCAAGGTTCATCTCGAGATGAACCTTGATATACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-975s21c1
Sequence:CCGGTGCTGAGGGAGTCGACTTAATCTCGAGATTAAGTCGACTCCCTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-721s21c1
Sequence:CCGGCCAGATTCCGCTGAGTATATCCTCGAGGATATACTCAGCGGAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-419s21c1
Sequence:CCGGAGCCAATAAATGACGTATTAGCTCGAGCTAATACGTCATTTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-307s1c1
Sequence:CCGGGAAGCCACCAACCTATAAGTTCTCGAGAACTTATAGGTTGGTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025485.1-386s1c1
Sequence:CCGGCGATTAAAGATGCCACCAGTTCTCGAGAACTGGTGGCATCTTTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-303s21c1
Sequence:CCGGACTGAAGCCACCAACCTATAACTCGAGTTATAGGTTGGTGGCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025485.2-1017s21c1
Sequence:CCGGAGCACAGAGAGGAGCATATATCTCGAGATATATGCTCCTCTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)