EMAIL THIS PAGE TO A FRIEND

MRPS23

mitochondrial ribosomal protein S23

82 Gene Product Result for
Synonyms: HSPC329 MRP-S23
UniProtKB ID: Q9Y3D9, B2R6V3, Q96Q24, Q9BWH8, Q9P053
Gene ID:
Human(51649) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 7p. [provided by RefSeq, Jul 2008]
Mouse(64656) mitochondrial ribosomal protein S23
Rat(360594) mitochondrial ribosomal protein S23
Zebrafish(445221) mitochondrial ribosomal protein S23
fruit fly(318977) mitochondrial Ribosomal protein S23
chicken(417666) mitochondrial ribosomal protein S23
cow(515228) mitochondrial ribosomal protein S23
domestic cat(101100521) mitochondrial ribosomal protein S23
dog(609917) mitochondrial ribosomal protein S23
sheep(101120254) mitochondrial ribosomal protein S23
naked mole-rat(101713646) mitochondrial ribosomal protein S23
domestic guinea pig(100726643) mitochondrial ribosomal protein S23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016070 Rosetta Predictions human pricing
NM_001108289 Rosetta Predictions rat pricing
NM_024174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075004 predicted 225
2 SASI_Hs01_00075006 predicted 469
3 SASI_Hs01_00075007 predicted 618
4 SASI_Hs01_00075008 predicted 436
5 SASI_Hs01_00075009 predicted 388
6 SASI_Hs01_00075011 predicted 631
7 SASI_Hs01_00075012 predicted 560
8 SASI_Hs01_00075013 predicted 664
9 SASI_Hs02_00348810 predicted 248
10 SASI_Hs02_00348811 predicted 199
11 SASI_Hs01_00075005 predicted 319
12 SASI_Hs01_00075010 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237189 predicted 455
2 SASI_Rn02_00237190 predicted 753
3 SASI_Rn02_00237191 predicted 443
4 SASI_Rn02_00237192 predicted 745
5 SASI_Rn02_00237193 predicted 284
6 SASI_Rn02_00237194 predicted 265
7 SASI_Rn02_00237195 predicted 337
8 SASI_Rn02_00237196 predicted 777
9 SASI_Rn02_00237197 predicted 597
10 SASI_Rn02_00237198 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327486 predicted 232
2 SASI_Mm02_00327487 predicted 351
3 SASI_Mm01_00023501 predicted 1004
4 SASI_Mm02_00327488 predicted 233
5 SASI_Mm01_00023503 predicted 359
6 SASI_Mm02_00327489 predicted 228
7 SASI_Mm02_00327490 predicted 282
8 SASI_Mm02_00327491 predicted 231
9 SASI_Mm02_00327492 predicted 224
10 SASI_Mm02_00327493 predicted 792
11 SASI_Mm01_00023497 predicted 357
12 SASI_Mm01_00023498 predicted 1053
13 SASI_Mm01_00023499 predicted 905
14 SASI_Mm01_00023500 predicted 222
15 SASI_Mm01_00023502 predicted 331
16 SASI_Mm01_00023504 predicted 313
17 SASI_Mm01_00023505 predicted 397
18 SASI_Mm01_00023506 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016070
VALIDATED
MRPS23 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S23
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-320s1c1
Sequence:CCGGCGGTTTGTGGAGAAGTACACTCTCGAGAGTGTACTTCTCCACAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-459s1c1
Sequence:CCGGGTAGTCACGTTTCCCGGAAATCTCGAGATTTCCGGGAAACGTGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016070.2-644s1c1
Sequence:CCGGCTGGCTGAATGTTGAGCTATTCTCGAGAATAGCTCAACATTCAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-179s1c1
Sequence:CCGGGTGCGATATGGCAAAGCCAAACTCGAGTTTGGCTTTGCCATATCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016070.2-746s1c1
Sequence:CCGGCAAAGCTCAGTATCATGGTTTCTCGAGAAACCATGATACTGAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-115s1c1
Sequence:CCGGCCTGTGGTTTGACGTATATGACTCGAGTCATATACGTCAAACCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-331s1c1
Sequence:CCGGGAAGTACACTGAGCTACAGAACTCGAGTTCTGTAGCTCAGTGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-296s1c1
Sequence:CCGGCCAAACTTCAAGTCTACCTGTCTCGAGACAGGTAGACTTGAAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-230s1c1
Sequence:CCGGGATCGGATTAGAGCGAAGTTTCTCGAGAAACTTCGCTCTAATCCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-526s1c1
Sequence:CCGGGACTCAGAAAGAAGTTCCACACTCGAGTGTGGAACTTCTTTCTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-114s21c1
Sequence:CCGGCCCTGTGGTTTGACGTATATGCTCGAGCATATACGTCAAACCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-362s21c1
Sequence:CCGGACAGATGAAGAGAAGTTATTTCTCGAGAAATAACTTCTCTTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016070.2-692s21c1
Sequence:CCGGTCTTGATCTCTAAGGTATTATCTCGAGATAATACCTTAGAGATCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-460s21c1
Sequence:CCGGTAGTCACGTTTCCCGGAAATCCTCGAGGATTTCCGGGAAACGTGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-220s21c1
Sequence:CCGGGTACCACGAGGATCGGATTAGCTCGAGCTAATCCGATCCTCGTGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016070
VALIDATED
MRPS23 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S23
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-320s1c1
Sequence:CCGGCGGTTTGTGGAGAAGTACACTCTCGAGAGTGTACTTCTCCACAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-459s1c1
Sequence:CCGGGTAGTCACGTTTCCCGGAAATCTCGAGATTTCCGGGAAACGTGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016070.2-644s1c1
Sequence:CCGGCTGGCTGAATGTTGAGCTATTCTCGAGAATAGCTCAACATTCAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-179s1c1
Sequence:CCGGGTGCGATATGGCAAAGCCAAACTCGAGTTTGGCTTTGCCATATCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016070.2-746s1c1
Sequence:CCGGCAAAGCTCAGTATCATGGTTTCTCGAGAAACCATGATACTGAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-115s1c1
Sequence:CCGGCCTGTGGTTTGACGTATATGACTCGAGTCATATACGTCAAACCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-331s1c1
Sequence:CCGGGAAGTACACTGAGCTACAGAACTCGAGTTCTGTAGCTCAGTGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-296s1c1
Sequence:CCGGCCAAACTTCAAGTCTACCTGTCTCGAGACAGGTAGACTTGAAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-230s1c1
Sequence:CCGGGATCGGATTAGAGCGAAGTTTCTCGAGAAACTTCGCTCTAATCCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-526s1c1
Sequence:CCGGGACTCAGAAAGAAGTTCCACACTCGAGTGTGGAACTTCTTTCTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-114s21c1
Sequence:CCGGCCCTGTGGTTTGACGTATATGCTCGAGCATATACGTCAAACCACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-362s21c1
Sequence:CCGGACAGATGAAGAGAAGTTATTTCTCGAGAAATAACTTCTCTTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016070.2-692s21c1
Sequence:CCGGTCTTGATCTCTAAGGTATTATCTCGAGATAATACCTTAGAGATCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-460s21c1
Sequence:CCGGTAGTCACGTTTCCCGGAAATCCTCGAGGATTTCCGGGAAACGTGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-220s21c1
Sequence:CCGGGTACCACGAGGATCGGATTAGCTCGAGCTAATCCGATCCTCGTGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016070
VALIDATED
MRPS23 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S23
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-320s1c1
Sequence:CCGGCGGTTTGTGGAGAAGTACACTCTCGAGAGTGTACTTCTCCACAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-459s1c1
Sequence:CCGGGTAGTCACGTTTCCCGGAAATCTCGAGATTTCCGGGAAACGTGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016070.2-644s1c1
Sequence:CCGGCTGGCTGAATGTTGAGCTATTCTCGAGAATAGCTCAACATTCAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-179s1c1
Sequence:CCGGGTGCGATATGGCAAAGCCAAACTCGAGTTTGGCTTTGCCATATCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016070.2-746s1c1
Sequence:CCGGCAAAGCTCAGTATCATGGTTTCTCGAGAAACCATGATACTGAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-115s1c1
Sequence:CCGGCCTGTGGTTTGACGTATATGACTCGAGTCATATACGTCAAACCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-331s1c1
Sequence:CCGGGAAGTACACTGAGCTACAGAACTCGAGTTCTGTAGCTCAGTGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-296s1c1
Sequence:CCGGCCAAACTTCAAGTCTACCTGTCTCGAGACAGGTAGACTTGAAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016070.2-230s1c1
Sequence:CCGGGATCGGATTAGAGCGAAGTTTCTCGAGAAACTTCGCTCTAATCCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016070.2-526s1c1
Sequence:CCGGGACTCAGAAAGAAGTTCCACACTCGAGTGTGGAACTTCTTTCTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-114s21c1
Sequence:CCGGCCCTGTGGTTTGACGTATATGCTCGAGCATATACGTCAAACCACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-362s21c1
Sequence:CCGGACAGATGAAGAGAAGTTATTTCTCGAGAAATAACTTCTCTTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016070.2-692s21c1
Sequence:CCGGTCTTGATCTCTAAGGTATTATCTCGAGATAATACCTTAGAGATCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-460s21c1
Sequence:CCGGTAGTCACGTTTCCCGGAAATCCTCGAGGATTTCCGGGAAACGTGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016070.2-220s21c1
Sequence:CCGGGTACCACGAGGATCGGATTAGCTCGAGCTAATCCGATCCTCGTGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024174
VALIDATED
MRPS23 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S23
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024174.4-192s1c1
Sequence:CCGGCAAAGCTGACATCCAGGACATCTCGAGATGTCCTGGATGTCAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024174.4-835s1c1
Sequence:CCGGGCATCTGAACTCTTTGGGCTTCTCGAGAAGCCCAAAGAGTTCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-358s21c1
Sequence:CCGGACAGATGAAGAGAAGTTATTTCTCGAGAAATAACTTCTCTTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-398s21c1
Sequence:CCGGTGTTGGCAGAAGGCATCATTTCTCGAGAAATGATGCCTTCTGCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024174.5-1101s21c1
Sequence:CCGGGCTCATAGGCTGCCTAGAAATCTCGAGATTTCTAGGCAGCCTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-254s21c1
Sequence:CCGGCCTATGGATCTGGTCAGAAAGCTCGAGCTTTCTGACCAGATCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-225s21c1
Sequence:CCGGGGATCAGATTCGAGCGAAATTCTCGAGAATTTCGCTCGAATCTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024174
VALIDATED
MRPS23 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S23
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024174.4-192s1c1
Sequence:CCGGCAAAGCTGACATCCAGGACATCTCGAGATGTCCTGGATGTCAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024174.4-835s1c1
Sequence:CCGGGCATCTGAACTCTTTGGGCTTCTCGAGAAGCCCAAAGAGTTCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-358s21c1
Sequence:CCGGACAGATGAAGAGAAGTTATTTCTCGAGAAATAACTTCTCTTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-398s21c1
Sequence:CCGGTGTTGGCAGAAGGCATCATTTCTCGAGAAATGATGCCTTCTGCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024174.5-1101s21c1
Sequence:CCGGGCTCATAGGCTGCCTAGAAATCTCGAGATTTCTAGGCAGCCTATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-254s21c1
Sequence:CCGGCCTATGGATCTGGTCAGAAAGCTCGAGCTTTCTGACCAGATCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-225s21c1
Sequence:CCGGGGATCAGATTCGAGCGAAATTCTCGAGAATTTCGCTCGAATCTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024174
VALIDATED
MRPS23 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S23
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024174.4-192s1c1
Sequence:CCGGCAAAGCTGACATCCAGGACATCTCGAGATGTCCTGGATGTCAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024174.4-835s1c1
Sequence:CCGGGCATCTGAACTCTTTGGGCTTCTCGAGAAGCCCAAAGAGTTCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-358s21c1
Sequence:CCGGACAGATGAAGAGAAGTTATTTCTCGAGAAATAACTTCTCTTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-398s21c1
Sequence:CCGGTGTTGGCAGAAGGCATCATTTCTCGAGAAATGATGCCTTCTGCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024174.5-1101s21c1
Sequence:CCGGGCTCATAGGCTGCCTAGAAATCTCGAGATTTCTAGGCAGCCTATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-254s21c1
Sequence:CCGGCCTATGGATCTGGTCAGAAAGCTCGAGCTTTCTGACCAGATCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024174.5-225s21c1
Sequence:CCGGGGATCAGATTCGAGCGAAATTCTCGAGAATTTCGCTCGAATCTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)