EMAIL THIS PAGE TO A FRIEND

MRPS24

mitochondrial ribosomal protein S24

56 Gene Product Result for
Synonyms: MRP-S24 S24mt bMRP-47 bMRP47
UniProtKB ID: Q96EL2, A4D1U9, P82668, Q96Q23, Q9P047
Gene ID:
Human(64951) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 11. Read-through transcription exists between this gene and the upstream upregulator of cell proliferation (URGCP) gene. [provided by RefSeq, Mar 2011]
Mouse(64660) mitochondrial ribosomal protein S24
Rat(498406) mitochondrial ribosomal protein S24
Zebrafish(553711) mitochondrial ribosomal protein S24
fruit fly(42870) mitochondrial ribosomal protein S24
domestic cat(101094579) mitochondrial ribosomal protein S24
cow(617466) mitochondrial ribosomal protein S24
domestic guinea pig(100718190) mitochondrial ribosomal protein S24
naked mole-rat(101726458) mitochondrial ribosomal protein S24
sheep(101122388) mitochondrial ribosomal protein S24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032014 Rosetta Predictions human pricing
NM_001077659 Rosetta Predictions rat pricing
NM_026080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213486 predicted 457
2 SASI_Hs01_00213487 predicted 461
3 SASI_Hs01_00213488 predicted 468
4 SASI_Hs02_00359189 predicted 233
5 SASI_Hs02_00359190 predicted 211
6 SASI_Hs01_00213489 predicted 351
7 SASI_Hs01_00213490 predicted 421
8 SASI_Hs02_00359191 predicted 219
9 SASI_Hs02_00359192 predicted 212
10 SASI_Hs02_00359193 predicted 218
11 SASI_Hs01_00213483 predicted 226
12 SASI_Hs01_00213484 predicted 210
13 SASI_Hs01_00213485 predicted 369
14 SASI_Hs01_00213491 predicted 370
15 SASI_Hs01_00213492 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207762 predicted 479
2 SASI_Rn02_00207763 predicted 421
3 SASI_Rn02_00207764 predicted 261
4 SASI_Rn02_00207765 predicted 273
5 SASI_Rn02_00207766 predicted 309
6 SASI_Rn02_00207767 predicted 524
7 SASI_Rn02_00207768 predicted 402
8 SASI_Rn02_00207769 predicted 215
9 SASI_Rn02_00207770 predicted 508
10 SASI_Rn02_00207771 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091832 predicted 456
2 SASI_Mm02_00329652 predicted 449
3 SASI_Mm01_00091833 predicted 345
4 SASI_Mm02_00329653 predicted 342
5 SASI_Mm02_00329654 predicted 341
6 SASI_Mm02_00329655 predicted 413
7 SASI_Mm01_00091831 predicted 211
8 SASI_Mm02_00329656 predicted 406
9 SASI_Mm01_00091834 predicted 223
10 SASI_Mm01_00091836 predicted 334
11 SASI_Mm01_00091835 predicted 328
12 SASI_Mm01_00091837 predicted 356
13 SASI_Mm01_00091838 predicted 366
14 SASI_Mm01_00091839 predicted 357
15 SASI_Mm01_00091840 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032014
MRPS24 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S24
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-492s21c1
Sequence:CCGGCAAATGTCCTGTGCGACTCCACTCGAGTGGAGTCGCACAGGACATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-230s21c1
Sequence:CCGGACTACATCGCCCACCGTAAAGCTCGAGCTTTACGGTGGGCGATGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-392s21c1
Sequence:CCGGGTAACCAGTTGGAGATCTGTGCTCGAGCACAGATCTCCAACTGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-391s1c1
Sequence:CCGGCACAAGTACTACTTCCTCGTGCTCGAGCACGAGGAAGTAGTACTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-378s1c1
Sequence:CCGGGCAGTTGTCTCCACACAAGTACTCGAGTACTTGTGTGGAGACAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-421s1c1
Sequence:CCGGGAAACTTTGCTGTCCTACTTTCTCGAGAAAGTAGGACAGCAAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-413s1c1
Sequence:CCGGGCTACAGTGAAACTTTGCTGTCTCGAGACAGCAAAGTTTCACTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-480s1c1
Sequence:CCGGCTCAAAGGTTGTGTATAAGTACTCGAGTACTTATACACAACCTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032014
MRPS24 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S24
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-492s21c1
Sequence:CCGGCAAATGTCCTGTGCGACTCCACTCGAGTGGAGTCGCACAGGACATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-230s21c1
Sequence:CCGGACTACATCGCCCACCGTAAAGCTCGAGCTTTACGGTGGGCGATGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-392s21c1
Sequence:CCGGGTAACCAGTTGGAGATCTGTGCTCGAGCACAGATCTCCAACTGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-391s1c1
Sequence:CCGGCACAAGTACTACTTCCTCGTGCTCGAGCACGAGGAAGTAGTACTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-378s1c1
Sequence:CCGGGCAGTTGTCTCCACACAAGTACTCGAGTACTTGTGTGGAGACAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-421s1c1
Sequence:CCGGGAAACTTTGCTGTCCTACTTTCTCGAGAAAGTAGGACAGCAAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-413s1c1
Sequence:CCGGGCTACAGTGAAACTTTGCTGTCTCGAGACAGCAAAGTTTCACTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-480s1c1
Sequence:CCGGCTCAAAGGTTGTGTATAAGTACTCGAGTACTTATACACAACCTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032014
MRPS24 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S24
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-492s21c1
Sequence:CCGGCAAATGTCCTGTGCGACTCCACTCGAGTGGAGTCGCACAGGACATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-230s21c1
Sequence:CCGGACTACATCGCCCACCGTAAAGCTCGAGCTTTACGGTGGGCGATGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032014.2-392s21c1
Sequence:CCGGGTAACCAGTTGGAGATCTGTGCTCGAGCACAGATCTCCAACTGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-391s1c1
Sequence:CCGGCACAAGTACTACTTCCTCGTGCTCGAGCACGAGGAAGTAGTACTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-378s1c1
Sequence:CCGGGCAGTTGTCTCCACACAAGTACTCGAGTACTTGTGTGGAGACAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-421s1c1
Sequence:CCGGGAAACTTTGCTGTCCTACTTTCTCGAGAAAGTAGGACAGCAAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-413s1c1
Sequence:CCGGGCTACAGTGAAACTTTGCTGTCTCGAGACAGCAAAGTTTCACTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032014.1-480s1c1
Sequence:CCGGCTCAAAGGTTGTGTATAAGTACTCGAGTACTTATACACAACCTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026080
VALIDATED
MRPS24 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S24
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.2-520s1c1
Sequence:CCGGGGTCGTGTACAAGTACATATACTCGAGTATATGTACTTGTACACGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-455s21c1
Sequence:CCGGGAGACTCTGTTGTCACACTTTCTCGAGAAAGTGTGACAACAGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-270s21c1
Sequence:CCGGGAGAAGATCATGCTGCAGAGACTCGAGTCTCTGCAGCATGATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-415s21c1
Sequence:CCGGGCTGCCAGCACACAAATTCTACTCGAGTAGAATTTGTGTGCTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-315s21c1
Sequence:CCGGGAAAGTTTATGATGGGCACCTCTCGAGAGGTGCCCATCATAAACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.1-337s1c1
Sequence:CCGGGCTGACCAGATTGTTCTGAAGCTCGAGCTTCAGAACAATCTGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-442s1c1
Sequence:CCGGGAGACTCTGTTGTCACACTTTCTCGAGAAAGTGTGACAACAGAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026080.1-657s1c1
Sequence:CCGGCTGGGTCTCTCTCTCTTTCTTCTCGAGAAGAAAGAGAGAGAGACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-402s1c1
Sequence:CCGGGCTGCCAGCACACAAATTCTACTCGAGTAGAATTTGTGTGCTGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-257s1c1
Sequence:CCGGGAGAAGATCATGCTGCAGAGACTCGAGTCTCTGCAGCATGATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026080.1-302s1c1
Sequence:CCGGGAAAGTTTATGATGGGCACCTCTCGAGAGGTGCCCATCATAAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.1-438s1c1
Sequence:CCGGCAGTGAGACTCTGTTGTCACACTCGAGTGTGACAACAGAGTCTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026080
VALIDATED
MRPS24 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S24
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.2-520s1c1
Sequence:CCGGGGTCGTGTACAAGTACATATACTCGAGTATATGTACTTGTACACGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-455s21c1
Sequence:CCGGGAGACTCTGTTGTCACACTTTCTCGAGAAAGTGTGACAACAGAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-270s21c1
Sequence:CCGGGAGAAGATCATGCTGCAGAGACTCGAGTCTCTGCAGCATGATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-415s21c1
Sequence:CCGGGCTGCCAGCACACAAATTCTACTCGAGTAGAATTTGTGTGCTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-315s21c1
Sequence:CCGGGAAAGTTTATGATGGGCACCTCTCGAGAGGTGCCCATCATAAACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.1-337s1c1
Sequence:CCGGGCTGACCAGATTGTTCTGAAGCTCGAGCTTCAGAACAATCTGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-442s1c1
Sequence:CCGGGAGACTCTGTTGTCACACTTTCTCGAGAAAGTGTGACAACAGAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026080.1-657s1c1
Sequence:CCGGCTGGGTCTCTCTCTCTTTCTTCTCGAGAAGAAAGAGAGAGAGACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-402s1c1
Sequence:CCGGGCTGCCAGCACACAAATTCTACTCGAGTAGAATTTGTGTGCTGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-257s1c1
Sequence:CCGGGAGAAGATCATGCTGCAGAGACTCGAGTCTCTGCAGCATGATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026080.1-302s1c1
Sequence:CCGGGAAAGTTTATGATGGGCACCTCTCGAGAGGTGCCCATCATAAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.1-438s1c1
Sequence:CCGGCAGTGAGACTCTGTTGTCACACTCGAGTGTGACAACAGAGTCTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026080
VALIDATED
MRPS24 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S24
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.2-520s1c1
Sequence:CCGGGGTCGTGTACAAGTACATATACTCGAGTATATGTACTTGTACACGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-455s21c1
Sequence:CCGGGAGACTCTGTTGTCACACTTTCTCGAGAAAGTGTGACAACAGAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-270s21c1
Sequence:CCGGGAGAAGATCATGCTGCAGAGACTCGAGTCTCTGCAGCATGATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-415s21c1
Sequence:CCGGGCTGCCAGCACACAAATTCTACTCGAGTAGAATTTGTGTGCTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026080.2-315s21c1
Sequence:CCGGGAAAGTTTATGATGGGCACCTCTCGAGAGGTGCCCATCATAAACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.1-337s1c1
Sequence:CCGGGCTGACCAGATTGTTCTGAAGCTCGAGCTTCAGAACAATCTGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-442s1c1
Sequence:CCGGGAGACTCTGTTGTCACACTTTCTCGAGAAAGTGTGACAACAGAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026080.1-657s1c1
Sequence:CCGGCTGGGTCTCTCTCTCTTTCTTCTCGAGAAGAAAGAGAGAGAGACCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-402s1c1
Sequence:CCGGGCTGCCAGCACACAAATTCTACTCGAGTAGAATTTGTGTGCTGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026080.1-257s1c1
Sequence:CCGGGAGAAGATCATGCTGCAGAGACTCGAGTCTCTGCAGCATGATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026080.1-302s1c1
Sequence:CCGGGAAAGTTTATGATGGGCACCTCTCGAGAGGTGCCCATCATAAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026080.1-438s1c1
Sequence:CCGGCAGTGAGACTCTGTTGTCACACTCGAGTGTGACAACAGAGTCTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)