EMAIL THIS PAGE TO A FRIEND

MRPS25

mitochondrial ribosomal protein S25

99 Gene Product Result for
Synonyms: MRP-S25 RPMS25
UniProtKB ID: P82663, Q9H7P5
Gene ID:
Human(64432) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 4. [provided by RefSeq, Jul 2008]
Mouse(64658) mitochondrial ribosomal protein S25
Rat(297459) mitochondrial ribosomal protein S25
Zebrafish(550252) mitochondrial ribosomal protein S25
chicken(416129) mitochondrial ribosomal protein S25
domestic cat(101099948) mitochondrial ribosomal protein S25
cow(533011) mitochondrial ribosomal protein S25
dog(476523) mitochondrial ribosomal protein S25
fruit fly(32395) mitochondrial ribosomal protein S25
sheep(101104277) mitochondrial ribosomal protein S25
naked mole-rat(101699710) mitochondrial ribosomal protein S25
domestic guinea pig(100721953) mitochondrial ribosomal protein S25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007881 MISSION® esiRNA esiRNA targeting human MRPS25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022497 Rosetta Predictions human pricing
NM_001025408 Rosetta Predictions rat pricing
NM_025578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232448 predicted 397
2 SASI_Hs01_00232449 predicted 492
3 SASI_Hs01_00232450 predicted 928
4 SASI_Hs01_00232451 predicted 299
5 SASI_Hs01_00232452 predicted 598
6 SASI_Hs01_00232453 predicted 259
7 SASI_Hs02_00355822 predicted 401
8 SASI_Hs02_00355823 predicted 487
9 SASI_Hs02_00355824 predicted 677
10 SASI_Hs01_00232455 predicted 655
11 SASI_Hs01_00232447 predicted 302
12 SASI_Hs01_00232454 predicted 806
13 SASI_Hs01_00232456 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110793 predicted 221
2 SASI_Rn01_00110794 predicted 324
3 SASI_Rn01_00110795 predicted 507
4 SASI_Rn01_00110796 predicted 399
5 SASI_Rn01_00110797 predicted 324
6 SASI_Rn01_00110798 predicted 316
7 SASI_Rn01_00110799 predicted 325
8 SASI_Rn01_00110800 predicted 402
9 SASI_Rn01_00110801 predicted 496
10 SASI_Rn01_00110802 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101266 predicted 904
2 SASI_Mm01_00101267 predicted 971
3 SASI_Mm01_00101268 predicted 338
4 SASI_Mm01_00101269 predicted 232
5 SASI_Mm01_00101270 predicted 864
6 SASI_Mm01_00101271 predicted 520
7 SASI_Mm01_00101272 predicted 821
8 SASI_Mm01_00101273 predicted 715
9 SASI_Mm01_00101274 predicted 728
10 SASI_Mm01_00101275 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022497
VALIDATED
MRPS25 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S25
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022497.3-3873s1c1
Sequence:CCGGGCCACATTGAAACAGCATTTACTCGAGTAAATGCTGTTTCAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022497.3-598s1c1
Sequence:CCGGGAAGTACAAAGCCGCTCTGAACTCGAGTTCAGAGCGGCTTTGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022497.3-301s1c1
Sequence:CCGGGCAGATCATGATGTTTAAGAACTCGAGTTCTTAAACATCATGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022497.3-390s1c1
Sequence:CCGGCCAAGAGCAATAAGGAGATCACTCGAGTGATCTCCTTATTGCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022497.3-391s1c1
Sequence:CCGGCAAGAGCAATAAGGAGATCATCTCGAGATGATCTCCTTATTGCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022497
VALIDATED
MRPS25 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S25
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022497.3-3873s1c1
Sequence:CCGGGCCACATTGAAACAGCATTTACTCGAGTAAATGCTGTTTCAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022497.3-598s1c1
Sequence:CCGGGAAGTACAAAGCCGCTCTGAACTCGAGTTCAGAGCGGCTTTGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022497.3-301s1c1
Sequence:CCGGGCAGATCATGATGTTTAAGAACTCGAGTTCTTAAACATCATGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022497.3-390s1c1
Sequence:CCGGCCAAGAGCAATAAGGAGATCACTCGAGTGATCTCCTTATTGCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022497.3-391s1c1
Sequence:CCGGCAAGAGCAATAAGGAGATCATCTCGAGATGATCTCCTTATTGCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022497
VALIDATED
MRPS25 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S25
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022497.3-3873s1c1
Sequence:CCGGGCCACATTGAAACAGCATTTACTCGAGTAAATGCTGTTTCAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022497.3-598s1c1
Sequence:CCGGGAAGTACAAAGCCGCTCTGAACTCGAGTTCAGAGCGGCTTTGTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022497.3-301s1c1
Sequence:CCGGGCAGATCATGATGTTTAAGAACTCGAGTTCTTAAACATCATGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022497.3-390s1c1
Sequence:CCGGCCAAGAGCAATAAGGAGATCACTCGAGTGATCTCCTTATTGCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022497.3-391s1c1
Sequence:CCGGCAAGAGCAATAAGGAGATCATCTCGAGATGATCTCCTTATTGCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025578
MRPS25 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025578.3-5049s1c1
Sequence:CCGGCCCTGATTGATGCCATGACTACTCGAGTAGTCATGGCATCAATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-141s1c1
Sequence:CCGGACCGTGAACTACAACACGTATCTCGAGATACGTGTTGTAGTTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-544s1c1
Sequence:CCGGCTGCTCTGAAAGCCAGTACTTCTCGAGAAGTACTGGCTTTCAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-206s1c1
Sequence:CCGGCCCTCAGATCCAGTATAAGAACTCGAGTTCTTATACTGGATCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-317s1c1
Sequence:CCGGCGTGGAGACGAAGAGTAATAACTCGAGTTATTACTCTTCGTCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025578
MRPS25 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025578.3-5049s1c1
Sequence:CCGGCCCTGATTGATGCCATGACTACTCGAGTAGTCATGGCATCAATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-141s1c1
Sequence:CCGGACCGTGAACTACAACACGTATCTCGAGATACGTGTTGTAGTTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-544s1c1
Sequence:CCGGCTGCTCTGAAAGCCAGTACTTCTCGAGAAGTACTGGCTTTCAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-206s1c1
Sequence:CCGGCCCTCAGATCCAGTATAAGAACTCGAGTTCTTATACTGGATCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-317s1c1
Sequence:CCGGCGTGGAGACGAAGAGTAATAACTCGAGTTATTACTCTTCGTCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025578
MRPS25 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025578.3-5049s1c1
Sequence:CCGGCCCTGATTGATGCCATGACTACTCGAGTAGTCATGGCATCAATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-141s1c1
Sequence:CCGGACCGTGAACTACAACACGTATCTCGAGATACGTGTTGTAGTTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-544s1c1
Sequence:CCGGCTGCTCTGAAAGCCAGTACTTCTCGAGAAGTACTGGCTTTCAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-206s1c1
Sequence:CCGGCCCTCAGATCCAGTATAAGAACTCGAGTTCTTATACTGGATCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025578.3-317s1c1
Sequence:CCGGCGTGGAGACGAAGAGTAATAACTCGAGTTATTACTCTTCGTCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)