EMAIL THIS PAGE TO A FRIEND

MRPS26

mitochondrial ribosomal protein S26

51 Gene Product Result for
Synonyms: C20orf193 GI008 MRP-S13 MRP-S26 MRPS13 NY-BR-87 RPMS13 dJ534B8.3
UniProtKB ID: Q9BYN8, Q96Q58
Gene ID:
Human(64949) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. This gene lies adjacent to and downstream of the gonadotropin-releasing hormone precursor gene. [provided by RefSeq, Jul 2008]
Mouse(99045) mitochondrial ribosomal protein S26
Rat(362216) mitochondrial ribosomal protein S26
Zebrafish(436691) mitochondrial ribosomal protein S26
cow(516004) mitochondrial ribosomal protein S26
domestic cat(101097228) mitochondrial ribosomal protein S26
dog(477175) mitochondrial ribosomal protein S26
chicken(768343) mitochondrial ribosomal protein S26
chicken(426561) mitochondrial ribosomal protein S26
fruit fly(40001) mitochondrial ribosomal protein S26
domestic guinea pig(100716289) mitochondrial ribosomal protein S26
naked mole-rat(101716685) mitochondrial ribosomal protein S26
sheep(101112501) mitochondrial ribosomal protein S26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030811 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030811 Rosetta Predictions human pricing
NM_001013206 Rosetta Predictions rat pricing
NM_207207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090479 predicted 708
2 SASI_Hs01_00090480 predicted 569
3 SASI_Hs01_00090481 predicted 575
4 SASI_Hs01_00090482 predicted 247
5 SASI_Hs01_00090483 predicted 566
6 SASI_Hs01_00090484 predicted 212
7 SASI_Hs01_00090485 predicted 547
8 SASI_Hs01_00090486 predicted 732
9 SASI_Hs02_00358388 predicted 184
10 SASI_Hs02_00358389 predicted 148
11 SASI_Hs01_00090487 predicted 881
12 SASI_Hs01_00090488 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078273 predicted 659
2 SASI_Rn01_00078274 predicted 585
3 SASI_Rn01_00078275 predicted 482
4 SASI_Rn01_00078276 predicted 671
5 SASI_Rn01_00078277 predicted 558
6 SASI_Rn01_00078278 predicted 584
7 SASI_Rn01_00078279 predicted 389
8 SASI_Rn01_00078281 predicted 323
9 SASI_Rn01_00078282 predicted 582
10 SASI_Rn02_00200995 predicted 269
11 SASI_Rn01_00078280 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155707 predicted 664
2 SASI_Mm01_00155708 predicted 552
3 SASI_Mm02_00351928 predicted 452
4 SASI_Mm01_00155709 predicted 529
5 SASI_Mm01_00155710 predicted 656
6 SASI_Mm01_00155711 predicted 652
7 SASI_Mm01_00155712 predicted 362
8 SASI_Mm01_00155713 predicted 557
9 SASI_Mm01_00155715 predicted 651
10 SASI_Mm01_00155716 predicted 228
11 SASI_Mm01_00155714 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207207
MRPS26 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S26
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207207.1-644s1c1
Sequence:CCGGGCCCAAATAAGCACAGTGCTTCTCGAGAAGCACTGTGCTTATTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207207.1-478s21c1
Sequence:CCGGGAAAGAGCAAGAAGTGCTCAACTCGAGTTGAGCACTTCTTGCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-470s1c1
Sequence:CCGGGTGCAACTGAAAGAGCAAGAACTCGAGTTCTTGCTCTTTCAGTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207207.1-806s1c1
Sequence:CCGGGACAAACTCAGGGCAGCATTACTCGAGTAATGCTGCCCTGAGTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207207.1-470s21c1
Sequence:CCGGGTGCAACTGAAAGAGCAAGAACTCGAGTTCTTGCTCTTTCAGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207207.1-644s21c1
Sequence:CCGGGCCCAAATAAGCACAGTGCTTCTCGAGAAGCACTGTGCTTATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-472s1c1
Sequence:CCGGGCAACTGAAAGAGCAAGAAGTCTCGAGACTTCTTGCTCTTTCAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-478s1c1
Sequence:CCGGGAAAGAGCAAGAAGTGCTCAACTCGAGTTGAGCACTTCTTGCTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207207.1-806s21c1
Sequence:CCGGGACAAACTCAGGGCAGCATTACTCGAGTAATGCTGCCCTGAGTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207207
MRPS26 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S26
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207207.1-644s1c1
Sequence:CCGGGCCCAAATAAGCACAGTGCTTCTCGAGAAGCACTGTGCTTATTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207207.1-478s21c1
Sequence:CCGGGAAAGAGCAAGAAGTGCTCAACTCGAGTTGAGCACTTCTTGCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-470s1c1
Sequence:CCGGGTGCAACTGAAAGAGCAAGAACTCGAGTTCTTGCTCTTTCAGTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207207.1-806s1c1
Sequence:CCGGGACAAACTCAGGGCAGCATTACTCGAGTAATGCTGCCCTGAGTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207207.1-470s21c1
Sequence:CCGGGTGCAACTGAAAGAGCAAGAACTCGAGTTCTTGCTCTTTCAGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207207.1-644s21c1
Sequence:CCGGGCCCAAATAAGCACAGTGCTTCTCGAGAAGCACTGTGCTTATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-472s1c1
Sequence:CCGGGCAACTGAAAGAGCAAGAAGTCTCGAGACTTCTTGCTCTTTCAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-478s1c1
Sequence:CCGGGAAAGAGCAAGAAGTGCTCAACTCGAGTTGAGCACTTCTTGCTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207207.1-806s21c1
Sequence:CCGGGACAAACTCAGGGCAGCATTACTCGAGTAATGCTGCCCTGAGTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207207
MRPS26 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S26
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207207.1-644s1c1
Sequence:CCGGGCCCAAATAAGCACAGTGCTTCTCGAGAAGCACTGTGCTTATTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207207.1-478s21c1
Sequence:CCGGGAAAGAGCAAGAAGTGCTCAACTCGAGTTGAGCACTTCTTGCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-470s1c1
Sequence:CCGGGTGCAACTGAAAGAGCAAGAACTCGAGTTCTTGCTCTTTCAGTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207207.1-806s1c1
Sequence:CCGGGACAAACTCAGGGCAGCATTACTCGAGTAATGCTGCCCTGAGTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207207.1-470s21c1
Sequence:CCGGGTGCAACTGAAAGAGCAAGAACTCGAGTTCTTGCTCTTTCAGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207207.1-644s21c1
Sequence:CCGGGCCCAAATAAGCACAGTGCTTCTCGAGAAGCACTGTGCTTATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-472s1c1
Sequence:CCGGGCAACTGAAAGAGCAAGAAGTCTCGAGACTTCTTGCTCTTTCAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207207.1-478s1c1
Sequence:CCGGGAAAGAGCAAGAAGTGCTCAACTCGAGTTGAGCACTTCTTGCTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207207.1-806s21c1
Sequence:CCGGGACAAACTCAGGGCAGCATTACTCGAGTAATGCTGCCCTGAGTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030811
VALIDATED
MRPS26 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S26
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030811.3-683s21c1
Sequence:CCGGCAGGGACCATGTATGTATCATCTCGAGATGATACATACATGGTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030811.3-592s1c1
Sequence:CCGGGAAGAACTACAACTGGGCCATCTCGAGATGGCCCAGTTGTAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-199s1c1
Sequence:CCGGCTTCGTGCTGATGGAGCGTTACTCGAGTAACGCTCCATCAGCACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030811.3-689s1c1
Sequence:CCGGCCATGTATGTATCATGGCGGACTCGAGTCCGCCATGATACATACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-720s1c1
Sequence:CCGGCTGACCTGGAATAAAGCAGTTCTCGAGAACTGCTTTATTCCAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030811.3-151s1c1
Sequence:CCGGCAAGATCGAGCGAGTGAACATCTCGAGATGTTCACTCGCTCGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030811.3-801s1c1
Sequence:CCGGCTGTCACCACTTGGTCAGAAACTCGAGTTTCTGACCAAGTGGTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030811.3-148s21c1
Sequence:CCGGATCCAAGATCGAGCGAGTGAACTCGAGTTCACTCGCTCGATCTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030811.3-199s21c1
Sequence:CCGGCTTCGTGCTGATGGAGCGTTACTCGAGTAACGCTCCATCAGCACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_030811.3-515s21c1
Sequence:CCGGCAGCTGCAGGAAGAGGTGAAACTCGAGTTTCACCTCTTCCTGCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-683s1c1
Sequence:CCGGCAGGGACCATGTATGTATCATCTCGAGATGATACATACATGGTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030811
VALIDATED
MRPS26 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S26
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030811.3-683s21c1
Sequence:CCGGCAGGGACCATGTATGTATCATCTCGAGATGATACATACATGGTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030811.3-592s1c1
Sequence:CCGGGAAGAACTACAACTGGGCCATCTCGAGATGGCCCAGTTGTAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-199s1c1
Sequence:CCGGCTTCGTGCTGATGGAGCGTTACTCGAGTAACGCTCCATCAGCACGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030811.3-689s1c1
Sequence:CCGGCCATGTATGTATCATGGCGGACTCGAGTCCGCCATGATACATACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-720s1c1
Sequence:CCGGCTGACCTGGAATAAAGCAGTTCTCGAGAACTGCTTTATTCCAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030811.3-151s1c1
Sequence:CCGGCAAGATCGAGCGAGTGAACATCTCGAGATGTTCACTCGCTCGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030811.3-801s1c1
Sequence:CCGGCTGTCACCACTTGGTCAGAAACTCGAGTTTCTGACCAAGTGGTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030811.3-148s21c1
Sequence:CCGGATCCAAGATCGAGCGAGTGAACTCGAGTTCACTCGCTCGATCTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030811.3-199s21c1
Sequence:CCGGCTTCGTGCTGATGGAGCGTTACTCGAGTAACGCTCCATCAGCACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_030811.3-515s21c1
Sequence:CCGGCAGCTGCAGGAAGAGGTGAAACTCGAGTTTCACCTCTTCCTGCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-683s1c1
Sequence:CCGGCAGGGACCATGTATGTATCATCTCGAGATGATACATACATGGTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030811
VALIDATED
MRPS26 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S26
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030811.3-683s21c1
Sequence:CCGGCAGGGACCATGTATGTATCATCTCGAGATGATACATACATGGTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030811.3-592s1c1
Sequence:CCGGGAAGAACTACAACTGGGCCATCTCGAGATGGCCCAGTTGTAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-199s1c1
Sequence:CCGGCTTCGTGCTGATGGAGCGTTACTCGAGTAACGCTCCATCAGCACGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030811.3-689s1c1
Sequence:CCGGCCATGTATGTATCATGGCGGACTCGAGTCCGCCATGATACATACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-720s1c1
Sequence:CCGGCTGACCTGGAATAAAGCAGTTCTCGAGAACTGCTTTATTCCAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030811.3-151s1c1
Sequence:CCGGCAAGATCGAGCGAGTGAACATCTCGAGATGTTCACTCGCTCGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030811.3-801s1c1
Sequence:CCGGCTGTCACCACTTGGTCAGAAACTCGAGTTTCTGACCAAGTGGTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030811.3-148s21c1
Sequence:CCGGATCCAAGATCGAGCGAGTGAACTCGAGTTCACTCGCTCGATCTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030811.3-199s21c1
Sequence:CCGGCTTCGTGCTGATGGAGCGTTACTCGAGTAACGCTCCATCAGCACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_030811.3-515s21c1
Sequence:CCGGCAGCTGCAGGAAGAGGTGAAACTCGAGTTTCACCTCTTCCTGCAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_030811.3-683s1c1
Sequence:CCGGCAGGGACCATGTATGTATCATCTCGAGATGATACATACATGGTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)