EMAIL THIS PAGE TO A FRIEND

MRPS27

mitochondrial ribosomal protein S27

55 Gene Product Result for
Synonyms: MRP-S27 S27mt
UniProtKB ID: Q92552, Q6P1S1
Gene ID:
Human(23107) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that may be a functional partner of the death associated protein 3 (DAP3). [provided by RefSeq, Jul 2008]
Mouse(218506) mitochondrial ribosomal protein S27
Rat(361883) mitochondrial ribosomal protein S27
sheep(101116256) mitochondrial ribosomal protein S27
naked mole-rat(101711557) mitochondrial ribosomal protein S27
domestic guinea pig(100735503) mitochondrial ribosomal protein S27
Zebrafish(445321) mitochondrial ribosomal protein S27
chicken(427216) mitochondrial ribosomal protein S27
domestic cat(101091995) mitochondrial ribosomal protein S27
cow(514740) mitochondrial ribosomal protein S27
dog(610387) mitochondrial ribosomal protein S27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015084 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015084 Rosetta Predictions human pricing
NM_001108543 Rosetta Predictions rat pricing
NM_173757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233837 predicted 278
2 SASI_Hs01_00233838 predicted 640
3 SASI_Hs01_00233839 predicted 1010
4 SASI_Hs02_00346961 predicted 407
5 SASI_Hs01_00233840 predicted 450
6 SASI_Hs01_00233841 predicted 416
7 SASI_Hs01_00233842 predicted 1187
8 SASI_Hs01_00233843 predicted 231
9 SASI_Hs01_00233844 predicted 633
10 SASI_Hs01_00233845 predicted 975
11 SASI_Hs01_00233836 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239679 predicted 272
2 SASI_Rn02_00239680 predicted 274
3 SASI_Rn02_00239681 predicted 327
4 SASI_Rn02_00239682 predicted 232
5 SASI_Rn02_00239683 predicted 202
6 SASI_Rn02_00239684 predicted 322
7 SASI_Rn02_00239685 predicted 202
8 SASI_Rn02_00239686 predicted 324
9 SASI_Rn02_00239687 predicted 244
10 SASI_Rn02_00239688 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114231 predicted 476
2 SASI_Mm02_00345407 predicted 636
3 SASI_Mm01_00114232 predicted 275
4 SASI_Mm01_00114233 predicted 349
5 SASI_Mm02_00345408 predicted 1023
6 SASI_Mm01_00114234 predicted 684
7 SASI_Mm01_00114236 predicted 1045
8 SASI_Mm01_00114238 predicted 1011
9 SASI_Mm01_00114239 predicted 391
10 SASI_Mm01_00114240 predicted 1255
11 SASI_Mm01_00114235 predicted 497
12 SASI_Mm01_00114237 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015084
VALIDATED
MRPS27 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S27
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1264s21c1
Sequence:CCGGGCAAAGGCATCTGCCTAATAGCTCGAGCTATTAGGCAGATGCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-398s21c1
Sequence:CCGGCACAAGACAAAGCCCTATATACTCGAGTATATAGGGCTTTGTCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1020s21c1
Sequence:CCGGTCAATACCTGGAACGATTTAACTCGAGTTAAATCGTTCCAGGTATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1517s21c1
Sequence:CCGGAGGACTCTTGAGGCTCATAATCTCGAGATTATGAGCCTCAAGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-200s1c1
Sequence:CCGGGCCTGTTAGTTCTTTAACAATCTCGAGATTGTTAAAGAACTAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-1739s1c1
Sequence:CCGGCCTCCTTTAGTAGGTGGGATTCTCGAGAATCCCACCTACTAAAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-2045s1c1
Sequence:CCGGGCTGTGGGATACTCACACATTCTCGAGAATGTGTGAGTATCCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015084.1-2312s1c1
Sequence:CCGGGCTCATTTATCAAGTAGGTAACTCGAGTTACCTACTTGATAAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015084.1-223s1c1
Sequence:CCGGCACGGCTTATAGACAACATTTCTCGAGAAATGTTGTCTATAAGCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015084
VALIDATED
MRPS27 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S27
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1264s21c1
Sequence:CCGGGCAAAGGCATCTGCCTAATAGCTCGAGCTATTAGGCAGATGCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-398s21c1
Sequence:CCGGCACAAGACAAAGCCCTATATACTCGAGTATATAGGGCTTTGTCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1020s21c1
Sequence:CCGGTCAATACCTGGAACGATTTAACTCGAGTTAAATCGTTCCAGGTATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1517s21c1
Sequence:CCGGAGGACTCTTGAGGCTCATAATCTCGAGATTATGAGCCTCAAGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-200s1c1
Sequence:CCGGGCCTGTTAGTTCTTTAACAATCTCGAGATTGTTAAAGAACTAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-1739s1c1
Sequence:CCGGCCTCCTTTAGTAGGTGGGATTCTCGAGAATCCCACCTACTAAAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-2045s1c1
Sequence:CCGGGCTGTGGGATACTCACACATTCTCGAGAATGTGTGAGTATCCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015084.1-2312s1c1
Sequence:CCGGGCTCATTTATCAAGTAGGTAACTCGAGTTACCTACTTGATAAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015084.1-223s1c1
Sequence:CCGGCACGGCTTATAGACAACATTTCTCGAGAAATGTTGTCTATAAGCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015084
VALIDATED
MRPS27 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S27
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1264s21c1
Sequence:CCGGGCAAAGGCATCTGCCTAATAGCTCGAGCTATTAGGCAGATGCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-398s21c1
Sequence:CCGGCACAAGACAAAGCCCTATATACTCGAGTATATAGGGCTTTGTCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1020s21c1
Sequence:CCGGTCAATACCTGGAACGATTTAACTCGAGTTAAATCGTTCCAGGTATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015084.2-1517s21c1
Sequence:CCGGAGGACTCTTGAGGCTCATAATCTCGAGATTATGAGCCTCAAGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-200s1c1
Sequence:CCGGGCCTGTTAGTTCTTTAACAATCTCGAGATTGTTAAAGAACTAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-1739s1c1
Sequence:CCGGCCTCCTTTAGTAGGTGGGATTCTCGAGAATCCCACCTACTAAAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015084.1-2045s1c1
Sequence:CCGGGCTGTGGGATACTCACACATTCTCGAGAATGTGTGAGTATCCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_015084.1-2312s1c1
Sequence:CCGGGCTCATTTATCAAGTAGGTAACTCGAGTTACCTACTTGATAAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015084.1-223s1c1
Sequence:CCGGCACGGCTTATAGACAACATTTCTCGAGAAATGTTGTCTATAAGCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173757
VALIDATED
MRPS27 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-211s1c1
Sequence:CCGGGCCTGTTAGTTCTTTATCAATCTCGAGATTGATAAAGAACTAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-352s1c1
Sequence:CCGGGATTAGACAGTGTCTGAAATACTCGAGTATTTCAGACACTGTCTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173757.2-155s1c1
Sequence:CCGGGAATACCATCTGGCTGATCTTCTCGAGAAGATCAGCCAGATGGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-550s1c1
Sequence:CCGGCCAGTTTCTCTCCCTCTATGTCTCGAGACATAGAGGGAGAGAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-164s1c1
Sequence:CCGGCTGGCTGATCTTGCATCCTTACTCGAGTAAGGATGCAAGATCAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173757
VALIDATED
MRPS27 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-211s1c1
Sequence:CCGGGCCTGTTAGTTCTTTATCAATCTCGAGATTGATAAAGAACTAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-352s1c1
Sequence:CCGGGATTAGACAGTGTCTGAAATACTCGAGTATTTCAGACACTGTCTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173757.2-155s1c1
Sequence:CCGGGAATACCATCTGGCTGATCTTCTCGAGAAGATCAGCCAGATGGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-550s1c1
Sequence:CCGGCCAGTTTCTCTCCCTCTATGTCTCGAGACATAGAGGGAGAGAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-164s1c1
Sequence:CCGGCTGGCTGATCTTGCATCCTTACTCGAGTAAGGATGCAAGATCAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173757
VALIDATED
MRPS27 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-211s1c1
Sequence:CCGGGCCTGTTAGTTCTTTATCAATCTCGAGATTGATAAAGAACTAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-352s1c1
Sequence:CCGGGATTAGACAGTGTCTGAAATACTCGAGTATTTCAGACACTGTCTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173757.2-155s1c1
Sequence:CCGGGAATACCATCTGGCTGATCTTCTCGAGAAGATCAGCCAGATGGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-550s1c1
Sequence:CCGGCCAGTTTCTCTCCCTCTATGTCTCGAGACATAGAGGGAGAGAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173757.2-164s1c1
Sequence:CCGGCTGGCTGATCTTGCATCCTTACTCGAGTAAGGATGCAAGATCAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)