EMAIL THIS PAGE TO A FRIEND

MRPS28

mitochondrial ribosomal protein S28

45 Gene Product Result for
Synonyms: MRP-S28 MRP-S35 MRPS35
UniProtKB ID: Q9Y2Q9, B2RDZ7, Q96Q21
Gene ID:
Human(28957) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has been called mitochondrial ribosomal protein S35 in the literature. [provided by RefSeq, Jul 2008]
Mouse(66230) mitochondrial ribosomal protein S28
Rat(689025) mitochondrial ribosomal protein S28
fruit fly(37136) mitochondrial ribosomal protein S28
chicken(770322) mitochondrial ribosomal protein S28
cow(535290) mitochondrial ribosomal protein S28
domestic cat(101091345) mitochondrial ribosomal protein S28
dog(477919) mitochondrial ribosomal protein S28
domestic guinea pig(100725541) mitochondrial ribosomal protein S28
naked mole-rat(101711254) mitochondrial ribosomal protein S28
sheep(101111812) mitochondrial ribosomal protein S28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014018 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014018 Rosetta Predictions human pricing
NM_001047909 Rosetta Predictions rat pricing
NM_025434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344990 predicted 319
2 SASI_Hs01_00235606 predicted 288
3 SASI_Hs01_00235607 predicted 268
4 SASI_Hs01_00235608 predicted 366
5 SASI_Hs01_00235609 predicted 265
6 SASI_Hs01_00235611 predicted 317
7 SASI_Hs01_00235612 predicted 325
8 SASI_Hs01_00235613 predicted 347
9 SASI_Hs02_00344991 predicted 443
10 SASI_Hs01_00235614 predicted 223
11 SASI_Hs01_00235610 predicted 352
12 SASI_Hs01_00235615 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206705 predicted 282
2 SASI_Rn02_00206706 predicted 236
3 SASI_Rn02_00206707 predicted 315
4 SASI_Rn02_00206708 predicted 484
5 SASI_Rn02_00206709 predicted 285
6 SASI_Rn02_00206710 predicted 473
7 SASI_Rn02_00206711 predicted 363
8 SASI_Rn02_00206712 predicted 436
9 SASI_Rn02_00206713 predicted 340
10 SASI_Rn02_00206714 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157966 predicted 224
2 SASI_Mm01_00157967 predicted 226
3 SASI_Mm01_00157968 predicted 395
4 SASI_Mm01_00157969 predicted 341
5 SASI_Mm01_00157970 predicted 348
6 SASI_Mm01_00157971 predicted 300
7 SASI_Mm01_00157972 predicted 321
8 SASI_Mm01_00157973 predicted 398
9 SASI_Mm01_00157974 predicted 298
10 SASI_Mm02_00328257 predicted 325
11 SASI_Mm01_00157975 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025434
VALIDATED
MRPS28 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S28
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025434.2-95s1c1
Sequence:CCGGCCAAGCCTTTGCGAAATGCAACTCGAGTTGCATTTCGCAAAGGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025434.2-597s1c1
Sequence:CCGGGCTTGCTGTATTTGAACCCATCTCGAGATGGGTTCAAATACAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025434.2-540s1c1
Sequence:CCGGCCAAGAGATCAGGGACTCAAACTCGAGTTTGAGTCCCTGATCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025434.2-598s1c1
Sequence:CCGGCTTGCTGTATTTGAACCCATTCTCGAGAATGGGTTCAAATACAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-405s21c1
Sequence:CCGGAGATGTGGATGGCGAGAAATACTCGAGTATTTCTCGCCATCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-598s21c1
Sequence:CCGGCTTGCTGTATTTGAACCCATTCTCGAGAATGGGTTCAAATACAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-95s21c1
Sequence:CCGGCCAAGCCTTTGCGAAATGCAACTCGAGTTGCATTTCGCAAAGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-540s21c1
Sequence:CCGGCCAAGAGATCAGGGACTCAAACTCGAGTTTGAGTCCCTGATCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025434
VALIDATED
MRPS28 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S28
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025434.2-95s1c1
Sequence:CCGGCCAAGCCTTTGCGAAATGCAACTCGAGTTGCATTTCGCAAAGGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025434.2-597s1c1
Sequence:CCGGGCTTGCTGTATTTGAACCCATCTCGAGATGGGTTCAAATACAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025434.2-540s1c1
Sequence:CCGGCCAAGAGATCAGGGACTCAAACTCGAGTTTGAGTCCCTGATCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025434.2-598s1c1
Sequence:CCGGCTTGCTGTATTTGAACCCATTCTCGAGAATGGGTTCAAATACAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-405s21c1
Sequence:CCGGAGATGTGGATGGCGAGAAATACTCGAGTATTTCTCGCCATCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-598s21c1
Sequence:CCGGCTTGCTGTATTTGAACCCATTCTCGAGAATGGGTTCAAATACAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-95s21c1
Sequence:CCGGCCAAGCCTTTGCGAAATGCAACTCGAGTTGCATTTCGCAAAGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-540s21c1
Sequence:CCGGCCAAGAGATCAGGGACTCAAACTCGAGTTTGAGTCCCTGATCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025434
VALIDATED
MRPS28 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S28
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025434.2-95s1c1
Sequence:CCGGCCAAGCCTTTGCGAAATGCAACTCGAGTTGCATTTCGCAAAGGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025434.2-597s1c1
Sequence:CCGGGCTTGCTGTATTTGAACCCATCTCGAGATGGGTTCAAATACAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025434.2-540s1c1
Sequence:CCGGCCAAGAGATCAGGGACTCAAACTCGAGTTTGAGTCCCTGATCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025434.2-598s1c1
Sequence:CCGGCTTGCTGTATTTGAACCCATTCTCGAGAATGGGTTCAAATACAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-405s21c1
Sequence:CCGGAGATGTGGATGGCGAGAAATACTCGAGTATTTCTCGCCATCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-598s21c1
Sequence:CCGGCTTGCTGTATTTGAACCCATTCTCGAGAATGGGTTCAAATACAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-95s21c1
Sequence:CCGGCCAAGCCTTTGCGAAATGCAACTCGAGTTGCATTTCGCAAAGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025434.2-540s21c1
Sequence:CCGGCCAAGAGATCAGGGACTCAAACTCGAGTTTGAGTCCCTGATCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014018
VALIDATED
MRPS28 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S28
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-345s1c1
Sequence:CCGGGTGGAGAATGATCTGTACATACTCGAGTATGTACAGATCATTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-317s1c1
Sequence:CCGGACTGGTCATTGGACGGATCTTCTCGAGAAGATCCGTCCAATGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-489s1c1
Sequence:CCGGGCAACAACAGATACAACTGTACTCGAGTACAGTTGTATCTGTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-271s1c1
Sequence:CCGGTGCTGAGACATTCTCCTCTTACTCGAGTAAGAGGAGAATGTCTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-450s1c1
Sequence:CCGGCGGCTATTAGATCTTGAACTTCTCGAGAAGTTCAAGATCTAATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-317s21c1
Sequence:CCGGACTGGTCATTGGACGGATCTTCTCGAGAAGATCCGTCCAATGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-450s21c1
Sequence:CCGGCGGCTATTAGATCTTGAACTTCTCGAGAAGTTCAAGATCTAATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-489s21c1
Sequence:CCGGGCAACAACAGATACAACTGTACTCGAGTACAGTTGTATCTGTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-271s21c1
Sequence:CCGGTGCTGAGACATTCTCCTCTTACTCGAGTAAGAGGAGAATGTCTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014018
VALIDATED
MRPS28 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S28
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-345s1c1
Sequence:CCGGGTGGAGAATGATCTGTACATACTCGAGTATGTACAGATCATTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-317s1c1
Sequence:CCGGACTGGTCATTGGACGGATCTTCTCGAGAAGATCCGTCCAATGACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-489s1c1
Sequence:CCGGGCAACAACAGATACAACTGTACTCGAGTACAGTTGTATCTGTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-271s1c1
Sequence:CCGGTGCTGAGACATTCTCCTCTTACTCGAGTAAGAGGAGAATGTCTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-450s1c1
Sequence:CCGGCGGCTATTAGATCTTGAACTTCTCGAGAAGTTCAAGATCTAATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-317s21c1
Sequence:CCGGACTGGTCATTGGACGGATCTTCTCGAGAAGATCCGTCCAATGACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-450s21c1
Sequence:CCGGCGGCTATTAGATCTTGAACTTCTCGAGAAGTTCAAGATCTAATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-489s21c1
Sequence:CCGGGCAACAACAGATACAACTGTACTCGAGTACAGTTGTATCTGTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-271s21c1
Sequence:CCGGTGCTGAGACATTCTCCTCTTACTCGAGTAAGAGGAGAATGTCTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014018
VALIDATED
MRPS28 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S28
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-345s1c1
Sequence:CCGGGTGGAGAATGATCTGTACATACTCGAGTATGTACAGATCATTCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-317s1c1
Sequence:CCGGACTGGTCATTGGACGGATCTTCTCGAGAAGATCCGTCCAATGACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-489s1c1
Sequence:CCGGGCAACAACAGATACAACTGTACTCGAGTACAGTTGTATCTGTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-271s1c1
Sequence:CCGGTGCTGAGACATTCTCCTCTTACTCGAGTAAGAGGAGAATGTCTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014018.2-450s1c1
Sequence:CCGGCGGCTATTAGATCTTGAACTTCTCGAGAAGTTCAAGATCTAATAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-317s21c1
Sequence:CCGGACTGGTCATTGGACGGATCTTCTCGAGAAGATCCGTCCAATGACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-450s21c1
Sequence:CCGGCGGCTATTAGATCTTGAACTTCTCGAGAAGTTCAAGATCTAATAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-489s21c1
Sequence:CCGGGCAACAACAGATACAACTGTACTCGAGTACAGTTGTATCTGTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014018.2-271s21c1
Sequence:CCGGTGCTGAGACATTCTCCTCTTACTCGAGTAAGAGGAGAATGTCTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)