EMAIL THIS PAGE TO A FRIEND

MRPS2

mitochondrial ribosomal protein S2

59 Gene Product Result for
Synonyms: MRP-S2 S2mt
UniProtKB ID: Q9Y399, Q5T899, Q9BSQ4
Gene ID:
Human(51116) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S2 family. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(118451) mitochondrial ribosomal protein S2
Rat(362094) mitochondrial ribosomal protein S2
Zebrafish(791211) mitochondrial ribosomal protein S2
fruit fly(33688) mitochondrial ribosomal protein S2
cow(505681) mitochondrial ribosomal protein S2
domestic cat(101081682) mitochondrial ribosomal protein S2
dog(608318) mitochondrial ribosomal protein S2
chicken(417140) mitochondrial ribosomal protein S2
naked mole-rat(101697241) mitochondrial ribosomal protein S2
domestic guinea pig(100725207) mitochondrial ribosomal protein S2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016034 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016034 Rosetta Predictions human pricing
NM_001108576 Rosetta Predictions rat pricing
NM_080452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046239 predicted 1162
2 SASI_Hs01_00046238 predicted 1040
3 SASI_Hs01_00046240 predicted 1080
4 SASI_Hs01_00046241 predicted 862
5 SASI_Hs01_00046242 predicted 365
6 SASI_Hs01_00046243 predicted 447
7 SASI_Hs01_00046244 predicted 666
8 SASI_Hs01_00046245 predicted 1219
9 SASI_Hs01_00046246 predicted 1119
10 SASI_Hs02_00348744 predicted 323
11 SASI_Hs01_00046247 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239999 predicted 368
2 SASI_Rn02_00240000 predicted 615
3 SASI_Rn02_00240001 predicted 702
4 SASI_Rn02_00240002 predicted 428
5 SASI_Rn02_00240003 predicted 507
6 SASI_Rn02_00240004 predicted 336
7 SASI_Rn02_00240005 predicted 757
8 SASI_Rn02_00240006 predicted 851
9 SASI_Rn02_00240007 predicted 607
10 SASI_Rn02_00240008 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048713 predicted 215
2 SASI_Mm01_00048714 predicted 757
3 SASI_Mm01_00048715 predicted 281
4 SASI_Mm01_00048716 predicted 1091
5 SASI_Mm02_00338108 predicted 864
6 SASI_Mm01_00048717 predicted 204
7 SASI_Mm01_00048718 predicted 1183
8 SASI_Mm01_00048720 predicted 217
9 SASI_Mm01_00048721 predicted 1042
10 SASI_Mm01_00048722 predicted 1189
11 SASI_Mm01_00048719 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016034
VALIDATED
MRPS2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-359s21c1
Sequence:CCGGTGGCTGTCGGCACAGGTTTATCTCGAGATAAACCTGTGCCGACAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-238s21c1
Sequence:CCGGGCACCGATTTCAACGACAAGACTCGAGTCTTGTCGTTGAAATCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016034.3-281s21c1
Sequence:CCGGCTCTGACTTCTTCAATGTCAACTCGAGTTGACATTGAAGAAGTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-1326s21c1
Sequence:CCGGCTTCTCAATCTAAATGCCTTTCTCGAGAAAGGCATTTAGATTGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016034.3-664s21c1
Sequence:CCGGACACGCTCAACAACATCTTTGCTCGAGCAAAGATGTTGTTGAGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-1255s1c1
Sequence:CCGGCTTCTCAATCTAAATGCCTTTCTCGAGAAAGGCATTTAGATTGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016034.2-170s1c1
Sequence:CCGGCCGATTTCAACGACAAGATTTCTCGAGAAATCTTGTCGTTGAAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-210s1c1
Sequence:CCGGCTCTGACTTCTTCAATGTCAACTCGAGTTGACATTGAAGAAGTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-447s1c1
Sequence:CCGGCCGGCAGTTCTCGTACCTGATCTCGAGATCAGGTACGAGAACTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-167s1c1
Sequence:CCGGGCACCGATTTCAACGACAAGACTCGAGTCTTGTCGTTGAAATCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016034
VALIDATED
MRPS2 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-359s21c1
Sequence:CCGGTGGCTGTCGGCACAGGTTTATCTCGAGATAAACCTGTGCCGACAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-238s21c1
Sequence:CCGGGCACCGATTTCAACGACAAGACTCGAGTCTTGTCGTTGAAATCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016034.3-281s21c1
Sequence:CCGGCTCTGACTTCTTCAATGTCAACTCGAGTTGACATTGAAGAAGTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-1326s21c1
Sequence:CCGGCTTCTCAATCTAAATGCCTTTCTCGAGAAAGGCATTTAGATTGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016034.3-664s21c1
Sequence:CCGGACACGCTCAACAACATCTTTGCTCGAGCAAAGATGTTGTTGAGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-1255s1c1
Sequence:CCGGCTTCTCAATCTAAATGCCTTTCTCGAGAAAGGCATTTAGATTGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016034.2-170s1c1
Sequence:CCGGCCGATTTCAACGACAAGATTTCTCGAGAAATCTTGTCGTTGAAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-210s1c1
Sequence:CCGGCTCTGACTTCTTCAATGTCAACTCGAGTTGACATTGAAGAAGTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-447s1c1
Sequence:CCGGCCGGCAGTTCTCGTACCTGATCTCGAGATCAGGTACGAGAACTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-167s1c1
Sequence:CCGGGCACCGATTTCAACGACAAGACTCGAGTCTTGTCGTTGAAATCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016034
VALIDATED
MRPS2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-359s21c1
Sequence:CCGGTGGCTGTCGGCACAGGTTTATCTCGAGATAAACCTGTGCCGACAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-238s21c1
Sequence:CCGGGCACCGATTTCAACGACAAGACTCGAGTCTTGTCGTTGAAATCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016034.3-281s21c1
Sequence:CCGGCTCTGACTTCTTCAATGTCAACTCGAGTTGACATTGAAGAAGTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016034.3-1326s21c1
Sequence:CCGGCTTCTCAATCTAAATGCCTTTCTCGAGAAAGGCATTTAGATTGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016034.3-664s21c1
Sequence:CCGGACACGCTCAACAACATCTTTGCTCGAGCAAAGATGTTGTTGAGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-1255s1c1
Sequence:CCGGCTTCTCAATCTAAATGCCTTTCTCGAGAAAGGCATTTAGATTGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016034.2-170s1c1
Sequence:CCGGCCGATTTCAACGACAAGATTTCTCGAGAAATCTTGTCGTTGAAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-210s1c1
Sequence:CCGGCTCTGACTTCTTCAATGTCAACTCGAGTTGACATTGAAGAAGTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-447s1c1
Sequence:CCGGCCGGCAGTTCTCGTACCTGATCTCGAGATCAGGTACGAGAACTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016034.2-167s1c1
Sequence:CCGGGCACCGATTTCAACGACAAGACTCGAGTCTTGTCGTTGAAATCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080452
VALIDATED
MRPS2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_080452.2-1346s1c1
Sequence:CCGGGCTGCACTACTAAAGAACTTACTCGAGTAAGTTCTTTAGTAGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_080452.2-437s1c1
Sequence:CCGGCGCAAGGGCATCATTCTGTTTCTCGAGAAACAGAATGATGCCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-390s1c1
Sequence:CCGGCCTTGAATCTCCAACTGGCTTCTCGAGAAGCCAGTTGGAGATTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-229s1c1
Sequence:CCGGGCATTCGGATTTCTTCAATGTCTCGAGACATTGAAGAAATCCGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-287s1c1
Sequence:CCGGCGAGTACACCTGGGACATAAACTCGAGTTTATGTCCCAGGTGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080452
VALIDATED
MRPS2 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_080452.2-1346s1c1
Sequence:CCGGGCTGCACTACTAAAGAACTTACTCGAGTAAGTTCTTTAGTAGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_080452.2-437s1c1
Sequence:CCGGCGCAAGGGCATCATTCTGTTTCTCGAGAAACAGAATGATGCCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-390s1c1
Sequence:CCGGCCTTGAATCTCCAACTGGCTTCTCGAGAAGCCAGTTGGAGATTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-229s1c1
Sequence:CCGGGCATTCGGATTTCTTCAATGTCTCGAGACATTGAAGAAATCCGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-287s1c1
Sequence:CCGGCGAGTACACCTGGGACATAAACTCGAGTTTATGTCCCAGGTGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080452
VALIDATED
MRPS2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_080452.2-1346s1c1
Sequence:CCGGGCTGCACTACTAAAGAACTTACTCGAGTAAGTTCTTTAGTAGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_080452.2-437s1c1
Sequence:CCGGCGCAAGGGCATCATTCTGTTTCTCGAGAAACAGAATGATGCCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-390s1c1
Sequence:CCGGCCTTGAATCTCCAACTGGCTTCTCGAGAAGCCAGTTGGAGATTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-229s1c1
Sequence:CCGGGCATTCGGATTTCTTCAATGTCTCGAGACATTGAAGAAATCCGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080452.2-287s1c1
Sequence:CCGGCGAGTACACCTGGGACATAAACTCGAGTTTATGTCCCAGGTGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)