EMAIL THIS PAGE TO A FRIEND

MRPS31

mitochondrial ribosomal protein S31

48 Gene Product Result for
Synonyms: IMOGN38 MRP-S31 S31mt
UniProtKB ID: Q92665, B2RCS3, Q5VYC8, Q8WTV8
Gene ID:
Human(10240) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The 28S subunit of the mammalian mitoribosome may play a crucial and characteristic role in translation initiation. This gene encodes a 28S subunit protein that has also been associated with type 1 diabetes; however, its relationship to the etiology of this disease remains to be clarified. Pseudogenes corresponding to this gene have been found on chromosomes 3 and 13. [provided by RefSeq, Jul 2008]
Mouse(57312) mitochondrial ribosomal protein S31
Rat(290850) mitochondrial ribosomal protein S31
domestic guinea pig(100720912) mitochondrial ribosomal protein S31
naked mole-rat(101707797) mitochondrial ribosomal protein S31
sheep(101121865) mitochondrial ribosomal protein S31
Zebrafish(407642) mitochondrial ribosomal protein S31
cow(534185) mitochondrial ribosomal protein S31
domestic cat(101090318) mitochondrial ribosomal protein S31
dog(477294) mitochondrial ribosomal protein S31
fruit fly(39749) mitochondrial ribosomal protein S31
chicken(418887) mitochondrial ribosomal protein S31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005830 Rosetta Predictions human pricing
NM_001106091 Rosetta Predictions rat pricing
NM_020560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187676 predicted 485
2 SASI_Hs01_00187677 predicted 494
3 SASI_Hs01_00187678 predicted 373
4 SASI_Hs01_00187679 predicted 1102
5 SASI_Hs01_00187680 predicted 385
6 SASI_Hs01_00187681 predicted 1106
7 SASI_Hs01_00187682 predicted 278
8 SASI_Hs01_00187683 predicted 1107
9 SASI_Hs01_00187684 predicted 476
10 SASI_Hs01_00187685 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215542 predicted 944
2 SASI_Rn02_00215543 predicted 892
3 SASI_Rn02_00215544 predicted 606
4 SASI_Rn02_00215545 predicted 903
5 SASI_Rn02_00215546 predicted 1101
6 SASI_Rn02_00215547 predicted 1077
7 SASI_Rn02_00215548 predicted 1055
8 SASI_Rn02_00215549 predicted 1105
9 SASI_Rn02_00215550 predicted 509
10 SASI_Rn02_00215551 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142388 predicted 612
2 SASI_Mm01_00142389 predicted 833
3 SASI_Mm01_00142390 predicted 308
4 SASI_Mm01_00142391 predicted 985
5 SASI_Mm01_00142392 predicted 436
6 SASI_Mm01_00142393 predicted 221
7 SASI_Mm01_00142394 predicted 980
8 SASI_Mm01_00142395 predicted 893
9 SASI_Mm02_00325592 predicted 615
10 SASI_Mm01_00142396 predicted 209
11 SASI_Mm01_00142397 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005830
VALIDATED
MRPS31 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S31
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005830.2-906s1c1
Sequence:CCGGGAATGGATTTGAAGAGCTGATCTCGAGATCAGCTCTTCAAATCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005830.2-638s1c1
Sequence:CCGGCAGATATGAAAGTTGCCAGATCTCGAGATCTGGCAACTTTCATATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005830.2-961s1c1
Sequence:CCGGCCAATTAACAATGAAGCAGGTCTCGAGACCTGCTTCATTGTTAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005830.2-426s1c1
Sequence:CCGGGCTTCGAAGAGCTACAGAATACTCGAGTATTCTGTAGCTCTTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-688s1c1
Sequence:CCGGGAGCTTCGGATTCAGTTTGATCTCGAGATCAAACTGAATCCGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-242s1c1
Sequence:CCGGCTGTTCGAACTGAGGAGACTTCTCGAGAAGTCTCCTCAGTTCGAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-868s1c1
Sequence:CCGGGCTAAGCAGTTAGCCACAGTACTCGAGTACTGTGGCTAACTGCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005830.2-733s1c1
Sequence:CCGGCAGGAGAAGACGGATGATCTTCTCGAGAAGATCATCCGTCTTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-106s1c1
Sequence:CCGGGCTGCGATTATGCTACTCACTCTCGAGAGTGAGTAGCATAATCGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005830.2-1024s1c1
Sequence:CCGGGAGAAACACCTGGAGAGCTTTCTCGAGAAAGCTCTCCAGGTGTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-742s21c1
Sequence:CCGGGAGCTTCGGATTCAGTTTGATCTCGAGATCAAACTGAATCCGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-480s21c1
Sequence:CCGGGCTTCGAAGAGCTACAGAATACTCGAGTATTCTGTAGCTCTTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-787s21c1
Sequence:CCGGCAGGAGAAGACGGATGATCTTCTCGAGAAGATCATCCGTCTTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-922s21c1
Sequence:CCGGGCTAAGCAGTTAGCCACAGTACTCGAGTACTGTGGCTAACTGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005830
VALIDATED
MRPS31 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S31
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005830.2-906s1c1
Sequence:CCGGGAATGGATTTGAAGAGCTGATCTCGAGATCAGCTCTTCAAATCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005830.2-638s1c1
Sequence:CCGGCAGATATGAAAGTTGCCAGATCTCGAGATCTGGCAACTTTCATATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005830.2-961s1c1
Sequence:CCGGCCAATTAACAATGAAGCAGGTCTCGAGACCTGCTTCATTGTTAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005830.2-426s1c1
Sequence:CCGGGCTTCGAAGAGCTACAGAATACTCGAGTATTCTGTAGCTCTTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-688s1c1
Sequence:CCGGGAGCTTCGGATTCAGTTTGATCTCGAGATCAAACTGAATCCGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-242s1c1
Sequence:CCGGCTGTTCGAACTGAGGAGACTTCTCGAGAAGTCTCCTCAGTTCGAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-868s1c1
Sequence:CCGGGCTAAGCAGTTAGCCACAGTACTCGAGTACTGTGGCTAACTGCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005830.2-733s1c1
Sequence:CCGGCAGGAGAAGACGGATGATCTTCTCGAGAAGATCATCCGTCTTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-106s1c1
Sequence:CCGGGCTGCGATTATGCTACTCACTCTCGAGAGTGAGTAGCATAATCGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005830.2-1024s1c1
Sequence:CCGGGAGAAACACCTGGAGAGCTTTCTCGAGAAAGCTCTCCAGGTGTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-742s21c1
Sequence:CCGGGAGCTTCGGATTCAGTTTGATCTCGAGATCAAACTGAATCCGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-480s21c1
Sequence:CCGGGCTTCGAAGAGCTACAGAATACTCGAGTATTCTGTAGCTCTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-787s21c1
Sequence:CCGGCAGGAGAAGACGGATGATCTTCTCGAGAAGATCATCCGTCTTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-922s21c1
Sequence:CCGGGCTAAGCAGTTAGCCACAGTACTCGAGTACTGTGGCTAACTGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005830
VALIDATED
MRPS31 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S31
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005830.2-906s1c1
Sequence:CCGGGAATGGATTTGAAGAGCTGATCTCGAGATCAGCTCTTCAAATCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005830.2-638s1c1
Sequence:CCGGCAGATATGAAAGTTGCCAGATCTCGAGATCTGGCAACTTTCATATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005830.2-961s1c1
Sequence:CCGGCCAATTAACAATGAAGCAGGTCTCGAGACCTGCTTCATTGTTAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005830.2-426s1c1
Sequence:CCGGGCTTCGAAGAGCTACAGAATACTCGAGTATTCTGTAGCTCTTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-688s1c1
Sequence:CCGGGAGCTTCGGATTCAGTTTGATCTCGAGATCAAACTGAATCCGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-242s1c1
Sequence:CCGGCTGTTCGAACTGAGGAGACTTCTCGAGAAGTCTCCTCAGTTCGAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-868s1c1
Sequence:CCGGGCTAAGCAGTTAGCCACAGTACTCGAGTACTGTGGCTAACTGCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005830.2-733s1c1
Sequence:CCGGCAGGAGAAGACGGATGATCTTCTCGAGAAGATCATCCGTCTTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005830.2-106s1c1
Sequence:CCGGGCTGCGATTATGCTACTCACTCTCGAGAGTGAGTAGCATAATCGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005830.2-1024s1c1
Sequence:CCGGGAGAAACACCTGGAGAGCTTTCTCGAGAAAGCTCTCCAGGTGTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-742s21c1
Sequence:CCGGGAGCTTCGGATTCAGTTTGATCTCGAGATCAAACTGAATCCGAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-480s21c1
Sequence:CCGGGCTTCGAAGAGCTACAGAATACTCGAGTATTCTGTAGCTCTTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-787s21c1
Sequence:CCGGCAGGAGAAGACGGATGATCTTCTCGAGAAGATCATCCGTCTTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005830.3-922s21c1
Sequence:CCGGGCTAAGCAGTTAGCCACAGTACTCGAGTACTGTGGCTAACTGCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020560
VALIDATED
MRPS31 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S31
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-194s1c1
Sequence:CCGGGCACTAGCAGATCAATCTGTACTCGAGTACAGATTGATCTGCTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-309s1c1
Sequence:CCGGGCTGGACATTATTAAGGACATCTCGAGATGTCCTTAATAATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020560.1-989s1c1
Sequence:CCGGCCGAATTCCATGAGCATATATCTCGAGATATATGCTCATGGAATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-711s1c1
Sequence:CCGGCAGTTCTCTTAAGCAGGAGAACTCGAGTTCTCCTGCTTAAGAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-986s1c1
Sequence:CCGGGCTCCGAATTCCATGAGCATACTCGAGTATGCTCATGGAATTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-275s21c1
Sequence:CCGGGCACTAGCAGATCAATCTGTACTCGAGTACAGATTGATCTGCTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-792s21c1
Sequence:CCGGCAGTTCTCTTAAGCAGGAGAACTCGAGTTCTCCTGCTTAAGAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-1067s21c1
Sequence:CCGGGCTCCGAATTCCATGAGCATACTCGAGTATGCTCATGGAATTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-390s21c1
Sequence:CCGGGCTGGACATTATTAAGGACATCTCGAGATGTCCTTAATAATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020560
VALIDATED
MRPS31 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S31
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-194s1c1
Sequence:CCGGGCACTAGCAGATCAATCTGTACTCGAGTACAGATTGATCTGCTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-309s1c1
Sequence:CCGGGCTGGACATTATTAAGGACATCTCGAGATGTCCTTAATAATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020560.1-989s1c1
Sequence:CCGGCCGAATTCCATGAGCATATATCTCGAGATATATGCTCATGGAATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-711s1c1
Sequence:CCGGCAGTTCTCTTAAGCAGGAGAACTCGAGTTCTCCTGCTTAAGAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-986s1c1
Sequence:CCGGGCTCCGAATTCCATGAGCATACTCGAGTATGCTCATGGAATTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-275s21c1
Sequence:CCGGGCACTAGCAGATCAATCTGTACTCGAGTACAGATTGATCTGCTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-792s21c1
Sequence:CCGGCAGTTCTCTTAAGCAGGAGAACTCGAGTTCTCCTGCTTAAGAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-1067s21c1
Sequence:CCGGGCTCCGAATTCCATGAGCATACTCGAGTATGCTCATGGAATTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-390s21c1
Sequence:CCGGGCTGGACATTATTAAGGACATCTCGAGATGTCCTTAATAATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020560
VALIDATED
MRPS31 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S31
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-194s1c1
Sequence:CCGGGCACTAGCAGATCAATCTGTACTCGAGTACAGATTGATCTGCTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-309s1c1
Sequence:CCGGGCTGGACATTATTAAGGACATCTCGAGATGTCCTTAATAATGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020560.1-989s1c1
Sequence:CCGGCCGAATTCCATGAGCATATATCTCGAGATATATGCTCATGGAATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-711s1c1
Sequence:CCGGCAGTTCTCTTAAGCAGGAGAACTCGAGTTCTCCTGCTTAAGAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020560.1-986s1c1
Sequence:CCGGGCTCCGAATTCCATGAGCATACTCGAGTATGCTCATGGAATTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-275s21c1
Sequence:CCGGGCACTAGCAGATCAATCTGTACTCGAGTACAGATTGATCTGCTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-792s21c1
Sequence:CCGGCAGTTCTCTTAAGCAGGAGAACTCGAGTTCTCCTGCTTAAGAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-1067s21c1
Sequence:CCGGGCTCCGAATTCCATGAGCATACTCGAGTATGCTCATGGAATTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020560.2-390s21c1
Sequence:CCGGGCTGGACATTATTAAGGACATCTCGAGATGTCCTTAATAATGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)