EMAIL THIS PAGE TO A FRIEND

MRPS33

mitochondrial ribosomal protein S33

101 Gene Product Result for
Synonyms: MRP-S33 PTD003 S33mt
UniProtKB ID: Q9Y291
Gene ID:
Human(51650) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The 28S subunit of the mammalian mitoribosome may play a crucial and characteristic role in translation initiation. This gene encodes a 28S subunit protein that is one of the more highly conserved mitochondrial ribosomal proteins among mammals, Drosophila and C. elegans. Splice variants that differ in the 5' UTR have been found for this gene; all variants encode the same protein. Pseudogenes corresponding to this gene are found on chromosomes 1q, 4p, 4q, and 20q [provided by RefSeq, Jul 2008]
Mouse(14548) mitochondrial ribosomal protein S33
Rat(296995) mitochondrial ribosomal protein S33
Zebrafish(432383) mitochondrial ribosomal protein S33
cow(523435) mitochondrial ribosomal protein S33
domestic cat(101082641) mitochondrial ribosomal protein S33
dog(488358) mitochondrial ribosomal protein S33
chicken(418119) mitochondrial ribosomal protein S33
fruit fly(41991) mitochondrial ribosomal protein S33
sheep(101107696) mitochondrial ribosomal protein S33
naked mole-rat(101703846) mitochondrial ribosomal protein S33
domestic guinea pig(100714510) mitochondrial ribosomal protein S33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016071 Rosetta Predictions human pricing
NM_053035 Rosetta Predictions human pricing
NM_001047863 Rosetta Predictions rat pricing
NM_001010930 Rosetta Predictions mouse pricing
NM_010270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348812 predicted 351
2 SASI_Hs01_00123028 predicted 334
3 SASI_Hs01_00123029 predicted 327
4 SASI_Hs01_00123030 predicted 359
5 SASI_Hs01_00123031 predicted 345
6 SASI_Hs01_00123033 predicted 341
7 SASI_Hs01_00123034 predicted 347
8 SASI_Hs01_00123035 predicted 476
9 SASI_Hs01_00123036 predicted 484
10 SASI_Hs02_00348813 predicted 470
11 SASI_Hs01_00123032 predicted 354
12 SASI_Hs01_00123037 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361850 predicted 292
2 SASI_Hs02_00361851 predicted 499
3 SASI_Hs02_00361852 predicted 164
4 SASI_Hs02_00361853 predicted 233
5 SASI_Hs02_00361854 predicted 221
6 SASI_Hs02_00361855 predicted 485
7 SASI_Hs01_00208882 predicted 305
8 SASI_Hs02_00361856 predicted 262
9 SASI_Hs02_00361857 predicted 638
10 SASI_Hs02_00361858 predicted 545
11 SASI_Hs01_00208880 predicted 254
12 SASI_Hs01_00208881 predicted 241
13 SASI_Hs01_00208883 predicted 260
14 SASI_Hs01_00208884 predicted 283
15 SASI_Hs01_00208885 predicted 263
16 SASI_Hs01_00208886 predicted 259
17 SASI_Hs01_00208887 predicted 395
18 SASI_Hs01_00208888 predicted 407
19 SASI_Hs01_00208889 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206305 predicted 348
2 SASI_Rn02_00206306 predicted 321
3 SASI_Rn02_00206307 predicted 230
4 SASI_Rn02_00206308 predicted 320
5 SASI_Rn02_00206309 predicted 241
6 SASI_Rn02_00206310 predicted 355
7 SASI_Rn02_00206311 predicted 357
8 SASI_Rn02_00206312 predicted 323
9 SASI_Rn02_00206313 predicted 229
10 SASI_Rn02_00206314 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108003 predicted 593
2 SASI_Mm01_00108005 predicted 674
3 SASI_Mm01_00108008 predicted 588
4 SASI_Mm02_00286911 predicted 589
5 SASI_Mm02_00286912 predicted 615
6 SASI_Mm02_00286913 predicted 649
7 SASI_Mm02_00286914 predicted 580
8 SASI_Mm01_00108004 predicted 683
9 SASI_Mm01_00108007 predicted 537
10 SASI_Mm02_00286915 predicted 546
11 SASI_Mm01_00108002 predicted 440
12 SASI_Mm01_00108006 predicted 536
13 SASI_Mm01_00108009 predicted 437
14 SASI_Mm01_00108010 predicted 501
15 SASI_Mm01_00108011 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143803 predicted 545
2 SASI_Mm01_00143804 predicted 707
3 SASI_Mm01_00143805 predicted 789
4 SASI_Mm02_00318182 predicted 555
5 SASI_Mm02_00318183 predicted 552
6 SASI_Mm01_00143809 predicted 700
7 SASI_Mm01_00143810 predicted 548
8 SASI_Mm02_00318184 predicted 640
9 SASI_Mm01_00143811 predicted 614
10 SASI_Mm02_00318185 predicted 537
11 SASI_Mm01_00143806 predicted 646
12 SASI_Mm01_00143807 predicted 826
13 SASI_Mm01_00143808 predicted 659
14 SASI_Mm01_00143812 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010270
VALIDATED
MRPS33 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S33
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010270.2-857s21c1
Sequence:CCGGTTTCTGGGACAGGGAGTATTGCTCGAGCAATACTCCCTGTCCCAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010270.2-325s21c1
Sequence:CCGGCAGGACTTTAAGGATGAGCAACTCGAGTTGCTCATCCTTAAAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010270.2-171s21c1
Sequence:CCGGGTCTACTGACTCAAAGTCCATCTCGAGATGGACTTTGAGTCAGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010270.2-226s21c1
Sequence:CCGGGCCAAGAAGAAAGAGACTTATCTCGAGATAAGTCTCTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010270.2-799s21c1
Sequence:CCGGGCCTTTGTATTCACCATTAAGCTCGAGCTTAATGGTGAATACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010270.2-881s1c1
Sequence:CCGGGCCTTGTGTATACAAGGTATTCTCGAGAATACCTTGTATACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-171s1c1
Sequence:CCGGGTCTACTGACTCAAAGTCCATCTCGAGATGGACTTTGAGTCAGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010270.2-325s1c1
Sequence:CCGGCAGGACTTTAAGGATGAGCAACTCGAGTTGCTCATCCTTAAAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-226s1c1
Sequence:CCGGGCCAAGAAGAAAGAGACTTATCTCGAGATAAGTCTCTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-390s1c1
Sequence:CCGGAGAAGGGAAGAGAGCTACAAACTCGAGTTTGTAGCTCTCTTCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010270
VALIDATED
MRPS33 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S33
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010270.2-857s21c1
Sequence:CCGGTTTCTGGGACAGGGAGTATTGCTCGAGCAATACTCCCTGTCCCAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010270.2-325s21c1
Sequence:CCGGCAGGACTTTAAGGATGAGCAACTCGAGTTGCTCATCCTTAAAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010270.2-171s21c1
Sequence:CCGGGTCTACTGACTCAAAGTCCATCTCGAGATGGACTTTGAGTCAGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010270.2-226s21c1
Sequence:CCGGGCCAAGAAGAAAGAGACTTATCTCGAGATAAGTCTCTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010270.2-799s21c1
Sequence:CCGGGCCTTTGTATTCACCATTAAGCTCGAGCTTAATGGTGAATACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010270.2-881s1c1
Sequence:CCGGGCCTTGTGTATACAAGGTATTCTCGAGAATACCTTGTATACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-171s1c1
Sequence:CCGGGTCTACTGACTCAAAGTCCATCTCGAGATGGACTTTGAGTCAGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010270.2-325s1c1
Sequence:CCGGCAGGACTTTAAGGATGAGCAACTCGAGTTGCTCATCCTTAAAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-226s1c1
Sequence:CCGGGCCAAGAAGAAAGAGACTTATCTCGAGATAAGTCTCTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-390s1c1
Sequence:CCGGAGAAGGGAAGAGAGCTACAAACTCGAGTTTGTAGCTCTCTTCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010270
VALIDATED
MRPS33 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S33
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010270.2-857s21c1
Sequence:CCGGTTTCTGGGACAGGGAGTATTGCTCGAGCAATACTCCCTGTCCCAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010270.2-325s21c1
Sequence:CCGGCAGGACTTTAAGGATGAGCAACTCGAGTTGCTCATCCTTAAAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010270.2-171s21c1
Sequence:CCGGGTCTACTGACTCAAAGTCCATCTCGAGATGGACTTTGAGTCAGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010270.2-226s21c1
Sequence:CCGGGCCAAGAAGAAAGAGACTTATCTCGAGATAAGTCTCTTTCTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010270.2-799s21c1
Sequence:CCGGGCCTTTGTATTCACCATTAAGCTCGAGCTTAATGGTGAATACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010270.2-881s1c1
Sequence:CCGGGCCTTGTGTATACAAGGTATTCTCGAGAATACCTTGTATACACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-171s1c1
Sequence:CCGGGTCTACTGACTCAAAGTCCATCTCGAGATGGACTTTGAGTCAGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010270.2-325s1c1
Sequence:CCGGCAGGACTTTAAGGATGAGCAACTCGAGTTGCTCATCCTTAAAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-226s1c1
Sequence:CCGGGCCAAGAAGAAAGAGACTTATCTCGAGATAAGTCTCTTTCTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010270.2-390s1c1
Sequence:CCGGAGAAGGGAAGAGAGCTACAAACTCGAGTTTGTAGCTCTCTTCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016071
VALIDATED
MRPS33 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S33
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016071.3-515s21c1
Sequence:CCGGGCGGAGAGAAGAAAGTGCATTCTCGAGAATGCACTTTCTTCTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016071.3-556s21c1
Sequence:CCGGGAGGAATGTCATCTTCCTAAACTCGAGTTTAGGAAGATGACATTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016071.3-418s21c1
Sequence:CCGGCTTCGTGGAAAGGAGAAACCACTCGAGTGGTTTCTCCTTTCCACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-497s1c1
Sequence:CCGGGCGGAGAGAAGAAAGTGCATTCTCGAGAATGCACTTTCTTCTCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-400s1c1
Sequence:CCGGCTTCGTGGAAAGGAGAAACCACTCGAGTGGTTTCTCCTTTCCACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-418s1c1
Sequence:CCGGCCAAAGAAAGGAGAAGGGAAACTCGAGTTTCCCTTCTCCTTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016071.2-498s1c1
Sequence:CCGGCGGAGAGAAGAAAGTGCATTTCTCGAGAAATGCACTTTCTTCTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-388s1c1
Sequence:CCGGCGACTAAAGAAGCTTCGTGGACTCGAGTCCACGAAGCTTCTTTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-273s1c1
Sequence:CCGGGAAGGAGACTTATGATTGGTACTCGAGTACCAATCATAAGTCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-222s1c1
Sequence:CCGGCAAGTCTATGAAAGTGGTGAACTCGAGTTCACCACTTTCATAGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-538s1c1
Sequence:CCGGGAGGAATGTCATCTTCCTAAACTCGAGTTTAGGAAGATGACATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-265s1c1
Sequence:CCGGGCCAAGAAGAAGGAGACTTATCTCGAGATAAGTCTCCTTCTTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016071
VALIDATED
MRPS33 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S33
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016071.3-515s21c1
Sequence:CCGGGCGGAGAGAAGAAAGTGCATTCTCGAGAATGCACTTTCTTCTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016071.3-556s21c1
Sequence:CCGGGAGGAATGTCATCTTCCTAAACTCGAGTTTAGGAAGATGACATTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016071.3-418s21c1
Sequence:CCGGCTTCGTGGAAAGGAGAAACCACTCGAGTGGTTTCTCCTTTCCACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-497s1c1
Sequence:CCGGGCGGAGAGAAGAAAGTGCATTCTCGAGAATGCACTTTCTTCTCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-400s1c1
Sequence:CCGGCTTCGTGGAAAGGAGAAACCACTCGAGTGGTTTCTCCTTTCCACGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-418s1c1
Sequence:CCGGCCAAAGAAAGGAGAAGGGAAACTCGAGTTTCCCTTCTCCTTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016071.2-498s1c1
Sequence:CCGGCGGAGAGAAGAAAGTGCATTTCTCGAGAAATGCACTTTCTTCTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-388s1c1
Sequence:CCGGCGACTAAAGAAGCTTCGTGGACTCGAGTCCACGAAGCTTCTTTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-273s1c1
Sequence:CCGGGAAGGAGACTTATGATTGGTACTCGAGTACCAATCATAAGTCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-222s1c1
Sequence:CCGGCAAGTCTATGAAAGTGGTGAACTCGAGTTCACCACTTTCATAGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-538s1c1
Sequence:CCGGGAGGAATGTCATCTTCCTAAACTCGAGTTTAGGAAGATGACATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-265s1c1
Sequence:CCGGGCCAAGAAGAAGGAGACTTATCTCGAGATAAGTCTCCTTCTTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016071
VALIDATED
MRPS33 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S33
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016071.3-515s21c1
Sequence:CCGGGCGGAGAGAAGAAAGTGCATTCTCGAGAATGCACTTTCTTCTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016071.3-556s21c1
Sequence:CCGGGAGGAATGTCATCTTCCTAAACTCGAGTTTAGGAAGATGACATTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016071.3-418s21c1
Sequence:CCGGCTTCGTGGAAAGGAGAAACCACTCGAGTGGTTTCTCCTTTCCACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-497s1c1
Sequence:CCGGGCGGAGAGAAGAAAGTGCATTCTCGAGAATGCACTTTCTTCTCTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-400s1c1
Sequence:CCGGCTTCGTGGAAAGGAGAAACCACTCGAGTGGTTTCTCCTTTCCACGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-418s1c1
Sequence:CCGGCCAAAGAAAGGAGAAGGGAAACTCGAGTTTCCCTTCTCCTTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016071.2-498s1c1
Sequence:CCGGCGGAGAGAAGAAAGTGCATTTCTCGAGAAATGCACTTTCTTCTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-388s1c1
Sequence:CCGGCGACTAAAGAAGCTTCGTGGACTCGAGTCCACGAAGCTTCTTTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-273s1c1
Sequence:CCGGGAAGGAGACTTATGATTGGTACTCGAGTACCAATCATAAGTCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016071.2-222s1c1
Sequence:CCGGCAAGTCTATGAAAGTGGTGAACTCGAGTTCACCACTTTCATAGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-538s1c1
Sequence:CCGGGAGGAATGTCATCTTCCTAAACTCGAGTTTAGGAAGATGACATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016071.2-265s1c1
Sequence:CCGGGCCAAGAAGAAGGAGACTTATCTCGAGATAAGTCTCCTTCTTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)