EMAIL THIS PAGE TO A FRIEND

MRPS34

mitochondrial ribosomal protein S34

59 Gene Product Result for
Synonyms: MRP-S12 MRP-S34 MRPS12
UniProtKB ID: P82930, Q9BVI7
Gene ID:
Human(65993) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. Alternate splice variants of this gene have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(79044) mitochondrial ribosomal protein S34
Rat(287126) mitochondrial ribosomal protein S34
Zebrafish(795846) mitochondrial ribosomal protein S34
fruit fly(39809) mitochondrial ribosomal protein S34
chicken(426987) mitochondrial ribosomal protein S34
cow(618357) mitochondrial ribosomal protein S34
domestic cat(101086528) mitochondrial ribosomal protein S34
dog(611101) mitochondrial ribosomal protein S34
domestic guinea pig(100727444) mitochondrial ribosomal protein S34
naked mole-rat(101697380) mitochondrial ribosomal protein S34
sheep(101110811) mitochondrial ribosomal protein S34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023936 Rosetta Predictions human pricing
NM_001105771 Rosetta Predictions rat pricing
NM_023260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111368 predicted 320
2 SASI_Hs01_00111369 predicted 411
3 SASI_Hs01_00111370 predicted 738
4 SASI_Hs01_00111371 predicted 719
5 SASI_Hs01_00111372 predicted 383
6 SASI_Hs01_00111373 predicted 323
7 SASI_Hs01_00111374 predicted 398
8 SASI_Hs01_00111375 predicted 608
9 SASI_Hs01_00111376 predicted 605
10 SASI_Hs01_00111377 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212366 predicted 435
2 SASI_Rn02_00212367 predicted 487
3 SASI_Rn02_00212368 predicted 272
4 SASI_Rn02_00212369 predicted 662
5 SASI_Rn02_00212370 predicted 432
6 SASI_Rn02_00212371 predicted 317
7 SASI_Rn02_00212372 predicted 464
8 SASI_Rn02_00212373 predicted 488
9 SASI_Rn02_00212374 predicted 258
10 SASI_Rn02_00212375 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173755 predicted 442
2 SASI_Mm02_00327009 predicted 539
3 SASI_Mm01_00173756 predicted 352
4 SASI_Mm01_00173757 predicted 447
5 SASI_Mm01_00173758 predicted 416
6 SASI_Mm01_00173760 predicted 432
7 SASI_Mm01_00173761 predicted 350
8 SASI_Mm01_00173762 predicted 321
9 SASI_Mm02_00327010 predicted 427
10 SASI_Mm01_00173763 predicted 559
11 SASI_Mm01_00173759 predicted 414
12 SASI_Mm01_00173764 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023260
VALIDATED
MRPS34 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S34
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-408s21c1
Sequence:CCGGCAAAGGGAAGAGTGAGGATACCTCGAGGTATCCTCACTCTTCCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-442s1c1
Sequence:CCGGGAGCAAGTCATGTACCACGATCTCGAGATCGTGGTACATGACTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-408s1c1
Sequence:CCGGCAAAGGGAAGAGTGAGGATACCTCGAGGTATCCTCACTCTTCCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-420s21c1
Sequence:CCGGTGAGGATACGGCTCGGGAAATCTCGAGATTTCCCGAGCCGTATCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-402s1c1
Sequence:CCGGGACTTTCAAAGGGAAGAGTGACTCGAGTCACTCTTCCCTTTGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-436s1c1
Sequence:CCGGGAAATCGAGCAAGTCATGTACCTCGAGGTACATGACTTGCTCGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-395s1c1
Sequence:CCGGGCATCCTGACTTTCAAAGGGACTCGAGTCCCTTTGAAAGTCAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023260.1-721s21c1
Sequence:CCGGGAGAGGTCCTGTGAGTCATTTCTCGAGAAATGACTCACAGGACCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-497s21c1
Sequence:CCGGTCACTGCGTTCACTGCGAAACCTCGAGGTTTCGCAGTGAACGCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-395s21c1
Sequence:CCGGGCATCCTGACTTTCAAAGGGACTCGAGTCCCTTTGAAAGTCAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023260
VALIDATED
MRPS34 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S34
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-408s21c1
Sequence:CCGGCAAAGGGAAGAGTGAGGATACCTCGAGGTATCCTCACTCTTCCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-442s1c1
Sequence:CCGGGAGCAAGTCATGTACCACGATCTCGAGATCGTGGTACATGACTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-408s1c1
Sequence:CCGGCAAAGGGAAGAGTGAGGATACCTCGAGGTATCCTCACTCTTCCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-420s21c1
Sequence:CCGGTGAGGATACGGCTCGGGAAATCTCGAGATTTCCCGAGCCGTATCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-402s1c1
Sequence:CCGGGACTTTCAAAGGGAAGAGTGACTCGAGTCACTCTTCCCTTTGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-436s1c1
Sequence:CCGGGAAATCGAGCAAGTCATGTACCTCGAGGTACATGACTTGCTCGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-395s1c1
Sequence:CCGGGCATCCTGACTTTCAAAGGGACTCGAGTCCCTTTGAAAGTCAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023260.1-721s21c1
Sequence:CCGGGAGAGGTCCTGTGAGTCATTTCTCGAGAAATGACTCACAGGACCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-497s21c1
Sequence:CCGGTCACTGCGTTCACTGCGAAACCTCGAGGTTTCGCAGTGAACGCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-395s21c1
Sequence:CCGGGCATCCTGACTTTCAAAGGGACTCGAGTCCCTTTGAAAGTCAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023260
VALIDATED
MRPS34 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S34
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-408s21c1
Sequence:CCGGCAAAGGGAAGAGTGAGGATACCTCGAGGTATCCTCACTCTTCCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-442s1c1
Sequence:CCGGGAGCAAGTCATGTACCACGATCTCGAGATCGTGGTACATGACTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-408s1c1
Sequence:CCGGCAAAGGGAAGAGTGAGGATACCTCGAGGTATCCTCACTCTTCCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-420s21c1
Sequence:CCGGTGAGGATACGGCTCGGGAAATCTCGAGATTTCCCGAGCCGTATCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-402s1c1
Sequence:CCGGGACTTTCAAAGGGAAGAGTGACTCGAGTCACTCTTCCCTTTGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-436s1c1
Sequence:CCGGGAAATCGAGCAAGTCATGTACCTCGAGGTACATGACTTGCTCGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023260.1-395s1c1
Sequence:CCGGGCATCCTGACTTTCAAAGGGACTCGAGTCCCTTTGAAAGTCAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023260.1-721s21c1
Sequence:CCGGGAGAGGTCCTGTGAGTCATTTCTCGAGAAATGACTCACAGGACCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-497s21c1
Sequence:CCGGTCACTGCGTTCACTGCGAAACCTCGAGGTTTCGCAGTGAACGCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023260.1-395s21c1
Sequence:CCGGGCATCCTGACTTTCAAAGGGACTCGAGTCCCTTTGAAAGTCAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023936
VALIDATED
MRPS34 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S34
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023936.1-534s21c1
Sequence:CCGGGCCATGATTATCGCAGAACGACTCGAGTCGTTCTGCGATAATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-534s1c1
Sequence:CCGGGCCATGATTATCGCAGAACGACTCGAGTCGTTCTGCGATAATCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023936.1-804s21c1
Sequence:CCGGTTCTGAGGGTCTGCATCTTAGCTCGAGCTAAGATGCAGACCCTCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_023936.1-617s21c1
Sequence:CCGGACCCTGGGATTACCCTGCAAACTCGAGTTTGCAGGGTAATCCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-593s1c1
Sequence:CCGGGAATGTGCAGAGGATACGCATCTCGAGATGCGTATCCTCTGCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-539s1c1
Sequence:CCGGGATTATCGCAGAACGACAGAACTCGAGTTCTGTCGTTCTGCGATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-536s1c1
Sequence:CCGGCATGATTATCGCAGAACGACACTCGAGTGTCGTTCTGCGATAATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-535s1c1
Sequence:CCGGCCATGATTATCGCAGAACGACCTCGAGGTCGTTCTGCGATAATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_023936.1-408s21c1
Sequence:CCGGGAGATCGAACACGTCATGTACCTCGAGGTACATGACGTGTTCGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023936.1-593s21c1
Sequence:CCGGGAATGTGCAGAGGATACGCATCTCGAGATGCGTATCCTCTGCACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023936
VALIDATED
MRPS34 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S34
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023936.1-534s21c1
Sequence:CCGGGCCATGATTATCGCAGAACGACTCGAGTCGTTCTGCGATAATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-534s1c1
Sequence:CCGGGCCATGATTATCGCAGAACGACTCGAGTCGTTCTGCGATAATCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023936.1-804s21c1
Sequence:CCGGTTCTGAGGGTCTGCATCTTAGCTCGAGCTAAGATGCAGACCCTCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_023936.1-617s21c1
Sequence:CCGGACCCTGGGATTACCCTGCAAACTCGAGTTTGCAGGGTAATCCCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-593s1c1
Sequence:CCGGGAATGTGCAGAGGATACGCATCTCGAGATGCGTATCCTCTGCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-539s1c1
Sequence:CCGGGATTATCGCAGAACGACAGAACTCGAGTTCTGTCGTTCTGCGATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-536s1c1
Sequence:CCGGCATGATTATCGCAGAACGACACTCGAGTGTCGTTCTGCGATAATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-535s1c1
Sequence:CCGGCCATGATTATCGCAGAACGACCTCGAGGTCGTTCTGCGATAATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_023936.1-408s21c1
Sequence:CCGGGAGATCGAACACGTCATGTACCTCGAGGTACATGACGTGTTCGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023936.1-593s21c1
Sequence:CCGGGAATGTGCAGAGGATACGCATCTCGAGATGCGTATCCTCTGCACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023936
VALIDATED
MRPS34 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S34
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023936.1-534s21c1
Sequence:CCGGGCCATGATTATCGCAGAACGACTCGAGTCGTTCTGCGATAATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-534s1c1
Sequence:CCGGGCCATGATTATCGCAGAACGACTCGAGTCGTTCTGCGATAATCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023936.1-804s21c1
Sequence:CCGGTTCTGAGGGTCTGCATCTTAGCTCGAGCTAAGATGCAGACCCTCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_023936.1-617s21c1
Sequence:CCGGACCCTGGGATTACCCTGCAAACTCGAGTTTGCAGGGTAATCCCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-593s1c1
Sequence:CCGGGAATGTGCAGAGGATACGCATCTCGAGATGCGTATCCTCTGCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-539s1c1
Sequence:CCGGGATTATCGCAGAACGACAGAACTCGAGTTCTGTCGTTCTGCGATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-536s1c1
Sequence:CCGGCATGATTATCGCAGAACGACACTCGAGTGTCGTTCTGCGATAATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_023936.1-535s1c1
Sequence:CCGGCCATGATTATCGCAGAACGACCTCGAGGTCGTTCTGCGATAATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_023936.1-408s21c1
Sequence:CCGGGAGATCGAACACGTCATGTACCTCGAGGTACATGACGTGTTCGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023936.1-593s21c1
Sequence:CCGGGAATGTGCAGAGGATACGCATCTCGAGATGCGTATCCTCTGCACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)