EMAIL THIS PAGE TO A FRIEND

MRPS35

mitochondrial ribosomal protein S35

63 Gene Product Result for
Synonyms: MDS023 MRP-S28 MRPS28
Gene ID:
Human(60488) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has had confusing nomenclature in the literature. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 3p, 5q, and 10q. [provided by RefSeq, Jul 2010]
Mouse(232536) mitochondrial ribosomal protein S35
Rat(297727) mitochondrial ribosomal protein S35
sheep(101109952) mitochondrial ribosomal protein S35
naked mole-rat(101714661) mitochondrial ribosomal protein S35
domestic guinea pig(100716982) mitochondrial ribosomal protein S35
Zebrafish(503880) mitochondrial ribosomal protein S35
fruit fly(38345) mitochondrial ribosomal protein S35
cow(513438) mitochondrial ribosomal protein S35
domestic cat(101083091) mitochondrial ribosomal protein S35
dog(477660) mitochondrial ribosomal protein S35
chicken(419048) mitochondrial ribosomal protein S35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021821 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021821 Rosetta Predictions human pricing
NM_001106628 Rosetta Predictions rat pricing
NM_145573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136127 predicted 586
2 SASI_Hs01_00136128 predicted 377
3 SASI_Hs01_00136130 predicted 549
4 SASI_Hs01_00136131 predicted 502
5 SASI_Hs01_00136132 predicted 681
6 SASI_Hs02_00355132 predicted 646
7 SASI_Hs01_00136134 predicted 776
8 SASI_Hs01_00136135 predicted 825
9 SASI_Hs01_00136136 predicted 700
10 SASI_Hs02_00355133 predicted 768
11 SASI_Hs01_00136129 predicted 585
12 SASI_Hs01_00136133 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220818 predicted 680
2 SASI_Rn02_00220819 predicted 611
3 SASI_Rn02_00220820 predicted 878
4 SASI_Rn02_00220821 predicted 326
5 SASI_Rn02_00220822 predicted 708
6 SASI_Rn02_00220823 predicted 426
7 SASI_Rn02_00220824 predicted 536
8 SASI_Rn02_00220825 predicted 626
9 SASI_Rn02_00220826 predicted 886
10 SASI_Rn02_00220827 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341089 predicted 377
2 SASI_Mm01_00096234 predicted 529
3 SASI_Mm02_00341090 predicted 648
4 SASI_Mm02_00341091 predicted 677
5 SASI_Mm02_00341092 predicted 238
6 SASI_Mm01_00096235 predicted 421
7 SASI_Mm01_00096236 predicted 741
8 SASI_Mm02_00341093 predicted 382
9 SASI_Mm02_00341094 predicted 598
10 SASI_Mm02_00341095 predicted 459
11 SASI_Mm01_00096232 predicted 633
12 SASI_Mm01_00096233 predicted 685
13 SASI_Mm01_00096237 predicted 813
14 SASI_Mm01_00096238 predicted 288
15 SASI_Mm01_00096239 predicted 353
16 SASI_Mm01_00096240 predicted 290
17 SASI_Mm01_00096241 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145573
VALIDATED
MRPS35 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S35
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-871s21c1
Sequence:CCGGGACCAAAGAGGTCGAGGATTACTCGAGTAATCCTCGACCTCTTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145573.1-400s1c1
Sequence:CCGGGCACTCGACAGTGATGAGAAACTCGAGTTTCTCATCACTGTCGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145573.1-534s1c1
Sequence:CCGGGAATTTAGACAATCATGCCAACTCGAGTTGGCATGATTGTCTAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-524s21c1
Sequence:CCGGGCCGTAACGTTAAGGGTTAAACTCGAGTTTAACCCTTAACGTTACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-133s21c1
Sequence:CCGGTACGGCATCCAGAAGCGAAAGCTCGAGCTTTCGCTTCTGGATGCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-619s21c1
Sequence:CCGGCACCGATGTGCTCACTATCACCTCGAGGTGATAGTGAGCACATCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-271s21c1
Sequence:CCGGTCGAATGGGATACCCAGTAAACTCGAGTTTACTGGGTATCCCATTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-465s21c1
Sequence:CCGGAGATTGATACAGCGGATTATGCTCGAGCATAATCCGCTGTATCAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145573.1-876s1c1
Sequence:CCGGGTGTGTCGTTCGTCTCAAGAACTCGAGTTCTTGAGACGAACGACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145573.1-645s1c1
Sequence:CCGGGAACTATGACTATGCAGTGTACTCGAGTACACTGCATAGTCATAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145573
VALIDATED
MRPS35 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S35
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-871s21c1
Sequence:CCGGGACCAAAGAGGTCGAGGATTACTCGAGTAATCCTCGACCTCTTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145573.1-400s1c1
Sequence:CCGGGCACTCGACAGTGATGAGAAACTCGAGTTTCTCATCACTGTCGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145573.1-534s1c1
Sequence:CCGGGAATTTAGACAATCATGCCAACTCGAGTTGGCATGATTGTCTAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-524s21c1
Sequence:CCGGGCCGTAACGTTAAGGGTTAAACTCGAGTTTAACCCTTAACGTTACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-133s21c1
Sequence:CCGGTACGGCATCCAGAAGCGAAAGCTCGAGCTTTCGCTTCTGGATGCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-619s21c1
Sequence:CCGGCACCGATGTGCTCACTATCACCTCGAGGTGATAGTGAGCACATCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-271s21c1
Sequence:CCGGTCGAATGGGATACCCAGTAAACTCGAGTTTACTGGGTATCCCATTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-465s21c1
Sequence:CCGGAGATTGATACAGCGGATTATGCTCGAGCATAATCCGCTGTATCAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145573.1-876s1c1
Sequence:CCGGGTGTGTCGTTCGTCTCAAGAACTCGAGTTCTTGAGACGAACGACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145573.1-645s1c1
Sequence:CCGGGAACTATGACTATGCAGTGTACTCGAGTACACTGCATAGTCATAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145573
VALIDATED
MRPS35 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S35
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-871s21c1
Sequence:CCGGGACCAAAGAGGTCGAGGATTACTCGAGTAATCCTCGACCTCTTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145573.1-400s1c1
Sequence:CCGGGCACTCGACAGTGATGAGAAACTCGAGTTTCTCATCACTGTCGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145573.1-534s1c1
Sequence:CCGGGAATTTAGACAATCATGCCAACTCGAGTTGGCATGATTGTCTAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-524s21c1
Sequence:CCGGGCCGTAACGTTAAGGGTTAAACTCGAGTTTAACCCTTAACGTTACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-133s21c1
Sequence:CCGGTACGGCATCCAGAAGCGAAAGCTCGAGCTTTCGCTTCTGGATGCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-619s21c1
Sequence:CCGGCACCGATGTGCTCACTATCACCTCGAGGTGATAGTGAGCACATCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-271s21c1
Sequence:CCGGTCGAATGGGATACCCAGTAAACTCGAGTTTACTGGGTATCCCATTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145573.2-465s21c1
Sequence:CCGGAGATTGATACAGCGGATTATGCTCGAGCATAATCCGCTGTATCAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145573.1-876s1c1
Sequence:CCGGGTGTGTCGTTCGTCTCAAGAACTCGAGTTCTTGAGACGAACGACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145573.1-645s1c1
Sequence:CCGGGAACTATGACTATGCAGTGTACTCGAGTACACTGCATAGTCATAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021821
VALIDATED
MRPS35 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S35
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-384s1c1
Sequence:CCGGGCATTTGACTCCTGTAGCAATCTCGAGATTGCTACAGGAGTCAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-894s1c1
Sequence:CCGGGCTCCTTGGTACTAAAGAAATCTCGAGATTTCTTTAGTACCAAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-1164s1c1
Sequence:CCGGGCAATGATTACTCCAGAGTTTCTCGAGAAACTCTGGAGTAATCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-384s21c1
Sequence:CCGGGCATTTGACTCCTGTAGCAATCTCGAGATTGCTACAGGAGTCAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021821.2-1164s21c1
Sequence:CCGGGCAATGATTACTCCAGAGTTTCTCGAGAAACTCTGGAGTAATCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-988s21c1
Sequence:CCGGGAATCCGTGAAGAGACTATTACTCGAGTAATAGTCTCTTCACGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-548s21c1
Sequence:CCGGGAGCACGAGTAGTAGTCTTAACTCGAGTTAAGACTACTACTCGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-644s1c1
Sequence:CCGGGCAAGACCACAGATGTGCTTACTCGAGTAAGCACATCTGTGGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-894s21c1
Sequence:CCGGGCTCCTTGGTACTAAAGAAATCTCGAGATTTCTTTAGTACCAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021821.2-1220s1c1
Sequence:CCGGCTCTGATTTCTTCTTGGTCTACTCGAGTAGACCAAGAAGAAATCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-548s1c1
Sequence:CCGGGAGCACGAGTAGTAGTCTTAACTCGAGTTAAGACTACTACTCGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-988s1c1
Sequence:CCGGGAATCCGTGAAGAGACTATTACTCGAGTAATAGTCTCTTCACGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-190s1c1
Sequence:CCGGCCAAGAAGAAAGGCACTACCTCTCGAGAGGTAGTGCCTTTCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021821
VALIDATED
MRPS35 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S35
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-384s1c1
Sequence:CCGGGCATTTGACTCCTGTAGCAATCTCGAGATTGCTACAGGAGTCAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-894s1c1
Sequence:CCGGGCTCCTTGGTACTAAAGAAATCTCGAGATTTCTTTAGTACCAAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-1164s1c1
Sequence:CCGGGCAATGATTACTCCAGAGTTTCTCGAGAAACTCTGGAGTAATCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-384s21c1
Sequence:CCGGGCATTTGACTCCTGTAGCAATCTCGAGATTGCTACAGGAGTCAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021821.2-1164s21c1
Sequence:CCGGGCAATGATTACTCCAGAGTTTCTCGAGAAACTCTGGAGTAATCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-988s21c1
Sequence:CCGGGAATCCGTGAAGAGACTATTACTCGAGTAATAGTCTCTTCACGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-548s21c1
Sequence:CCGGGAGCACGAGTAGTAGTCTTAACTCGAGTTAAGACTACTACTCGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-644s1c1
Sequence:CCGGGCAAGACCACAGATGTGCTTACTCGAGTAAGCACATCTGTGGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-894s21c1
Sequence:CCGGGCTCCTTGGTACTAAAGAAATCTCGAGATTTCTTTAGTACCAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021821.2-1220s1c1
Sequence:CCGGCTCTGATTTCTTCTTGGTCTACTCGAGTAGACCAAGAAGAAATCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-548s1c1
Sequence:CCGGGAGCACGAGTAGTAGTCTTAACTCGAGTTAAGACTACTACTCGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-988s1c1
Sequence:CCGGGAATCCGTGAAGAGACTATTACTCGAGTAATAGTCTCTTCACGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-190s1c1
Sequence:CCGGCCAAGAAGAAAGGCACTACCTCTCGAGAGGTAGTGCCTTTCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021821
VALIDATED
MRPS35 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S35
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-384s1c1
Sequence:CCGGGCATTTGACTCCTGTAGCAATCTCGAGATTGCTACAGGAGTCAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-894s1c1
Sequence:CCGGGCTCCTTGGTACTAAAGAAATCTCGAGATTTCTTTAGTACCAAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-1164s1c1
Sequence:CCGGGCAATGATTACTCCAGAGTTTCTCGAGAAACTCTGGAGTAATCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-384s21c1
Sequence:CCGGGCATTTGACTCCTGTAGCAATCTCGAGATTGCTACAGGAGTCAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021821.2-1164s21c1
Sequence:CCGGGCAATGATTACTCCAGAGTTTCTCGAGAAACTCTGGAGTAATCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-988s21c1
Sequence:CCGGGAATCCGTGAAGAGACTATTACTCGAGTAATAGTCTCTTCACGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-548s21c1
Sequence:CCGGGAGCACGAGTAGTAGTCTTAACTCGAGTTAAGACTACTACTCGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-644s1c1
Sequence:CCGGGCAAGACCACAGATGTGCTTACTCGAGTAAGCACATCTGTGGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021821.2-894s21c1
Sequence:CCGGGCTCCTTGGTACTAAAGAAATCTCGAGATTTCTTTAGTACCAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021821.2-1220s1c1
Sequence:CCGGCTCTGATTTCTTCTTGGTCTACTCGAGTAGACCAAGAAGAAATCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021821.2-548s1c1
Sequence:CCGGGAGCACGAGTAGTAGTCTTAACTCGAGTTAAGACTACTACTCGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-988s1c1
Sequence:CCGGGAATCCGTGAAGAGACTATTACTCGAGTAATAGTCTCTTCACGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021821.2-190s1c1
Sequence:CCGGCCAAGAAGAAAGGCACTACCTCTCGAGAGGTAGTGCCTTTCTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)