EMAIL THIS PAGE TO A FRIEND

MRPS36

mitochondrial ribosomal protein S36

153 Gene Product Result for
Synonyms: MRP-S36
UniProtKB ID: P82909, Q9H2H4
Gene ID:
Human(92259) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. The mitochondrial ribosome (mitoribosome) consists of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. Pseudogenes corresponding to this gene are found on chromosomes 3p, 4q, 8p, 11q, 12q, and 20p. [provided by RefSeq, Jul 2008]
Mouse(66128) mitochondrial ribosomal protein S36
Rat(294696) mitochondrial ribosomal protein S36
chicken(771273) mitochondrial ribosomal protein S36
dog(478085) mitochondrial ribosomal protein S36
domestic cat(101086534) mitochondrial ribosomal protein S36
cow(613835) mitochondrial ribosomal protein S36
domestic guinea pig(100727058) mitochondrial ribosomal protein S36
naked mole-rat(101701388) mitochondrial ribosomal protein S36
sheep(101120193) mitochondrial ribosomal protein S36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026951 MISSION® esiRNA esiRNA human MRPS36 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033281 Rosetta Predictions human pricing
XM_001071159 Rosetta Predictions rat pricing
XM_215468 Rosetta Predictions rat pricing
NM_025369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135028 predicted 418
2 SASI_Hs01_00135029 predicted 218
3 SASI_Hs02_00361087 predicted 529
4 SASI_Hs01_00135031 predicted 340
5 SASI_Hs01_00135032 predicted 405
6 SASI_Hs01_00135033 predicted 414
7 SASI_Hs01_00135034 predicted 457
8 SASI_Hs01_00135035 predicted 225
9 SASI_Hs01_00135036 predicted 219
10 SASI_Hs01_00135037 predicted 572
11 SASI_Hs01_00135030 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334034 predicted 801
2 SASI_Rn02_00334035 predicted 295
3 SASI_Rn02_00334036 predicted 450
4 SASI_Rn02_00334037 predicted 502
5 SASI_Rn02_00334038 predicted 626
6 SASI_Rn02_00334039 predicted 744
7 SASI_Rn02_00334040 predicted 599
8 SASI_Rn02_00334041 predicted 488
9 SASI_Rn02_00334042 predicted 752
10 SASI_Rn02_00334043 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376025 predicted 802
2 SASI_Rn02_00376026 predicted 291
3 SASI_Rn02_00376027 predicted 450
4 SASI_Rn02_00376028 predicted 500
5 SASI_Rn02_00376029 predicted 630
6 SASI_Rn02_00376030 predicted 740
7 SASI_Rn02_00376031 predicted 601
8 SASI_Rn02_00376032 predicted 490
9 SASI_Rn02_00376033 predicted 746
10 SASI_Rn02_00376034 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063822 predicted 392
2 SASI_Mm01_00063823 predicted 399
3 SASI_Mm01_00063824 predicted 404
4 SASI_Mm01_00063830 predicted 207
5 SASI_Mm01_00063831 predicted 213
6 SASI_Mm02_00328085 predicted 205
7 SASI_Mm02_00328086 predicted 403
8 SASI_Mm01_00063826 predicted 310
9 SASI_Mm02_00328087 predicted 321
10 SASI_Mm02_00328088 predicted 324
11 SASI_Mm01_00063825 predicted 406
12 SASI_Mm01_00063827 predicted 430
13 SASI_Mm01_00063828 predicted 280
14 SASI_Mm01_00063829 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033281
VALIDATED
MRPS36 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S36
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033281.4-279s1c1
Sequence:CCGGCACCGGACACTGCAGAAATAACTCGAGTTATTTCTGCAGTGTCCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-203s1c1
Sequence:CCGGCTACCATCTCACTCTTCTGTACTCGAGTACAGAAGAGTGAGATGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-116s1c1
Sequence:CCGGGTCAAACCACACACTCCATTACTCGAGTAATGGAGTGTGTGGTTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-257s1c1
Sequence:CCGGGATTTGCTGATGTATCAGGGTCTCGAGACCCTGATACATCAGCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033281.4-1153s1c1
Sequence:CCGGCCATTAACCTTCTCAAACTTACTCGAGTAAGTTTGAGAAGGTTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033281.5-535s21c1
Sequence:CCGGGACACTTGTATTTCCTAATTTCTCGAGAAATTAGGAAATACAAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-152s21c1
Sequence:CCGGTAAGGTTTCCTGACAGAAGAGCTCGAGCTCTTCTGTCAGGAAACCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-295s21c1
Sequence:CCGGCCAGACACTGCAGAAATAATACTCGAGTATTATTTCTGCAGTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-243s21c1
Sequence:CCGGACAACATTCTAAAGGAAGTAACTCGAGTTACTTCCTTTAGAATGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-341s21c1
Sequence:CCGGGGAAACTTGTGTCTCAAGAAGCTCGAGCTTCTTGAGACACAAGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-174s21c1
Sequence:CCGGCAATCCTAAACCCAATGTATCCTCGAGGATACATTGGGTTTAGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033281
VALIDATED
MRPS36 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S36
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033281.4-279s1c1
Sequence:CCGGCACCGGACACTGCAGAAATAACTCGAGTTATTTCTGCAGTGTCCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-203s1c1
Sequence:CCGGCTACCATCTCACTCTTCTGTACTCGAGTACAGAAGAGTGAGATGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-116s1c1
Sequence:CCGGGTCAAACCACACACTCCATTACTCGAGTAATGGAGTGTGTGGTTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-257s1c1
Sequence:CCGGGATTTGCTGATGTATCAGGGTCTCGAGACCCTGATACATCAGCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033281.4-1153s1c1
Sequence:CCGGCCATTAACCTTCTCAAACTTACTCGAGTAAGTTTGAGAAGGTTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033281.5-535s21c1
Sequence:CCGGGACACTTGTATTTCCTAATTTCTCGAGAAATTAGGAAATACAAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-152s21c1
Sequence:CCGGTAAGGTTTCCTGACAGAAGAGCTCGAGCTCTTCTGTCAGGAAACCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-295s21c1
Sequence:CCGGCCAGACACTGCAGAAATAATACTCGAGTATTATTTCTGCAGTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-243s21c1
Sequence:CCGGACAACATTCTAAAGGAAGTAACTCGAGTTACTTCCTTTAGAATGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-341s21c1
Sequence:CCGGGGAAACTTGTGTCTCAAGAAGCTCGAGCTTCTTGAGACACAAGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-174s21c1
Sequence:CCGGCAATCCTAAACCCAATGTATCCTCGAGGATACATTGGGTTTAGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033281
VALIDATED
MRPS36 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S36
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033281.4-279s1c1
Sequence:CCGGCACCGGACACTGCAGAAATAACTCGAGTTATTTCTGCAGTGTCCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-203s1c1
Sequence:CCGGCTACCATCTCACTCTTCTGTACTCGAGTACAGAAGAGTGAGATGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-116s1c1
Sequence:CCGGGTCAAACCACACACTCCATTACTCGAGTAATGGAGTGTGTGGTTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_033281.4-257s1c1
Sequence:CCGGGATTTGCTGATGTATCAGGGTCTCGAGACCCTGATACATCAGCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033281.4-1153s1c1
Sequence:CCGGCCATTAACCTTCTCAAACTTACTCGAGTAAGTTTGAGAAGGTTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033281.5-535s21c1
Sequence:CCGGGACACTTGTATTTCCTAATTTCTCGAGAAATTAGGAAATACAAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-152s21c1
Sequence:CCGGTAAGGTTTCCTGACAGAAGAGCTCGAGCTCTTCTGTCAGGAAACCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-295s21c1
Sequence:CCGGCCAGACACTGCAGAAATAATACTCGAGTATTATTTCTGCAGTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-243s21c1
Sequence:CCGGACAACATTCTAAAGGAAGTAACTCGAGTTACTTCCTTTAGAATGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-341s21c1
Sequence:CCGGGGAAACTTGTGTCTCAAGAAGCTCGAGCTTCTTGAGACACAAGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033281.5-174s21c1
Sequence:CCGGCAATCCTAAACCCAATGTATCCTCGAGGATACATTGGGTTTAGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025369
VALIDATED
MRPS36 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S36
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025369.1-216s1c1
Sequence:CCGGGCAATTTCACAGCATTCTAAACTCGAGTTTAGAATGCTGTGAAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025369.1-342s1c1
Sequence:CCGGGAAATGGAATTTATCCAGCGTCTCGAGACGCTGGATAAATTCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025369.1-405s1c1
Sequence:CCGGCAGAAGGGTTAGCTTTACAATCTCGAGATTGTAAAGCTAACCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-400s1c1
Sequence:CCGGCCAGACAGAAGGGTTAGCTTTCTCGAGAAAGCTAACCCTTCTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-159s1c1
Sequence:CCGGCCTAAACTCAGTGCCTCAGAACTCGAGTTCTGAGGCACTGAGTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-223s1c1
Sequence:CCGGCACAGCATTCTAAAGGAAGTACTCGAGTACTTCCTTTAGAATGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-399s21c1
Sequence:CCGGCCAGACAGAAGGGTTAGCTTTCTCGAGAAAGCTAACCCTTCTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-158s21c1
Sequence:CCGGCCTAAACTCAGTGCCTCAGAACTCGAGTTCTGAGGCACTGAGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-110s21c1
Sequence:CCGGGTGAAGCCACACGCTCCATTACTCGAGTAATGGAGCGTGTGGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-274s21c1
Sequence:CCGGACCAGACACTGCAGAAATTATCTCGAGATAATTTCTGCAGTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-315s21c1
Sequence:CCGGACAGAAGGAAACCTATGTCTCCTCGAGGAGACATAGGTTTCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025369
VALIDATED
MRPS36 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S36
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025369.1-216s1c1
Sequence:CCGGGCAATTTCACAGCATTCTAAACTCGAGTTTAGAATGCTGTGAAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025369.1-342s1c1
Sequence:CCGGGAAATGGAATTTATCCAGCGTCTCGAGACGCTGGATAAATTCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025369.1-405s1c1
Sequence:CCGGCAGAAGGGTTAGCTTTACAATCTCGAGATTGTAAAGCTAACCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-400s1c1
Sequence:CCGGCCAGACAGAAGGGTTAGCTTTCTCGAGAAAGCTAACCCTTCTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-159s1c1
Sequence:CCGGCCTAAACTCAGTGCCTCAGAACTCGAGTTCTGAGGCACTGAGTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-223s1c1
Sequence:CCGGCACAGCATTCTAAAGGAAGTACTCGAGTACTTCCTTTAGAATGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-399s21c1
Sequence:CCGGCCAGACAGAAGGGTTAGCTTTCTCGAGAAAGCTAACCCTTCTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-158s21c1
Sequence:CCGGCCTAAACTCAGTGCCTCAGAACTCGAGTTCTGAGGCACTGAGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-110s21c1
Sequence:CCGGGTGAAGCCACACGCTCCATTACTCGAGTAATGGAGCGTGTGGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-274s21c1
Sequence:CCGGACCAGACACTGCAGAAATTATCTCGAGATAATTTCTGCAGTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-315s21c1
Sequence:CCGGACAGAAGGAAACCTATGTCTCCTCGAGGAGACATAGGTTTCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025369
VALIDATED
MRPS36 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S36
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025369.1-216s1c1
Sequence:CCGGGCAATTTCACAGCATTCTAAACTCGAGTTTAGAATGCTGTGAAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025369.1-342s1c1
Sequence:CCGGGAAATGGAATTTATCCAGCGTCTCGAGACGCTGGATAAATTCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025369.1-405s1c1
Sequence:CCGGCAGAAGGGTTAGCTTTACAATCTCGAGATTGTAAAGCTAACCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-400s1c1
Sequence:CCGGCCAGACAGAAGGGTTAGCTTTCTCGAGAAAGCTAACCCTTCTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-159s1c1
Sequence:CCGGCCTAAACTCAGTGCCTCAGAACTCGAGTTCTGAGGCACTGAGTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025369.1-223s1c1
Sequence:CCGGCACAGCATTCTAAAGGAAGTACTCGAGTACTTCCTTTAGAATGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-399s21c1
Sequence:CCGGCCAGACAGAAGGGTTAGCTTTCTCGAGAAAGCTAACCCTTCTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-158s21c1
Sequence:CCGGCCTAAACTCAGTGCCTCAGAACTCGAGTTCTGAGGCACTGAGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-110s21c1
Sequence:CCGGGTGAAGCCACACGCTCCATTACTCGAGTAATGGAGCGTGTGGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-274s21c1
Sequence:CCGGACCAGACACTGCAGAAATTATCTCGAGATAATTTCTGCAGTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025369.2-315s21c1
Sequence:CCGGACAGAAGGAAACCTATGTCTCCTCGAGGAGACATAGGTTTCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)