EMAIL THIS PAGE TO A FRIEND

MRPS5

mitochondrial ribosomal protein S5

49 Gene Product Result for
Synonyms: MRP-S5 S5mt
UniProtKB ID: P82675, Q4ZFY5, Q96LJ6, Q9BWI4, Q9BYC4
Gene ID:
Human(64969) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]
Mouse(77721) mitochondrial ribosomal protein S5
Rat(296134) mitochondrial ribosomal protein S5
Zebrafish(562703) mitochondrial ribosomal protein S5
fruit fly(3355089) mitochondrial ribosomal protein S5
domestic cat(101086554) mitochondrial ribosomal protein S5
cow(512469) mitochondrial ribosomal protein S5
dog(475746) mitochondrial ribosomal protein S5
chicken(416706) mitochondrial ribosomal protein S5
sheep(101117239) mitochondrial ribosomal protein S5
naked mole-rat(101697818) mitochondrial ribosomal protein S5
Domestic Rabbit(100337880) mitochondrial ribosomal protein S5
domestic guinea pig(100714307) mitochondrial ribosomal protein S5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113731 MISSION® esiRNA esiRNA human MRPS5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031902 Rosetta Predictions human pricing
NM_001106505 Rosetta Predictions rat pricing
NM_029963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074243 predicted 1001
2 SASI_Hs01_00074244 predicted 1222
3 SASI_Hs01_00074245 predicted 877
4 SASI_Hs01_00074246 predicted 1003
5 SASI_Hs01_00074247 predicted 1432
6 SASI_Hs01_00074248 predicted 1004
7 SASI_Hs01_00074249 predicted 289
8 SASI_Hs01_00074250 predicted 1407
9 SASI_Hs01_00074251 predicted 1323
10 SASI_Hs01_00074252 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219628 predicted 609
2 SASI_Rn02_00219629 predicted 1031
3 SASI_Rn02_00219630 predicted 1192
4 SASI_Rn02_00219631 predicted 1061
5 SASI_Rn02_00219632 predicted 1175
6 SASI_Rn02_00219633 predicted 1010
7 SASI_Rn02_00219634 predicted 1428
8 SASI_Rn02_00219635 predicted 1044
9 SASI_Rn02_00219636 predicted 554
10 SASI_Rn02_00219637 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067234 predicted 307
2 SASI_Mm01_00067235 predicted 431
3 SASI_Mm01_00067236 predicted 865
4 SASI_Mm01_00067237 predicted 426
5 SASI_Mm01_00067238 predicted 858
6 SASI_Mm01_00067239 predicted 828
7 SASI_Mm01_00067240 predicted 666
8 SASI_Mm01_00067241 predicted 671
9 SASI_Mm01_00067242 predicted 819
10 SASI_Mm01_00067243 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031902
VALIDATED
MRPS5 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-609s21c1
Sequence:CCGGATCATTGGTGAAGGGCGTTATCTCGAGATAACGCCCTTCACCAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-877s21c1
Sequence:CCGGCCAGGATACTTGAGGTAAGAACTCGAGTTCTTACCTCAAGTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-1220s21c1
Sequence:CCGGCAAGGTCTCTGGGTCCATTAACTCGAGTTAATGGACCCAGAGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-460s21c1
Sequence:CCGGGCCAGCAGTATAGACCATATACTCGAGTATATGGTCTATACTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-1042s21c1
Sequence:CCGGCAGTTCACCATTTGCATTATACTCGAGTATAATGCAAATGGTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1042s1c1
Sequence:CCGGCAGTTCACCATTTGCATTATACTCGAGTATAATGCAAATGGTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-877s1c1
Sequence:CCGGCCAGGATACTTGAGGTAAGAACTCGAGTTCTTACCTCAAGTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1305s1c1
Sequence:CCGGGCTGATAAGAAGGGCCTCCATCTCGAGATGGAGGCCCTTCTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1472s1c1
Sequence:CCGGGCGCTCTGTGTGGTCTAATTTCTCGAGAAATTAGACCACACAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-460s1c1
Sequence:CCGGGCCAGCAGTATAGACCATATACTCGAGTATATGGTCTATACTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031902
VALIDATED
MRPS5 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-609s21c1
Sequence:CCGGATCATTGGTGAAGGGCGTTATCTCGAGATAACGCCCTTCACCAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-877s21c1
Sequence:CCGGCCAGGATACTTGAGGTAAGAACTCGAGTTCTTACCTCAAGTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-1220s21c1
Sequence:CCGGCAAGGTCTCTGGGTCCATTAACTCGAGTTAATGGACCCAGAGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-460s21c1
Sequence:CCGGGCCAGCAGTATAGACCATATACTCGAGTATATGGTCTATACTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-1042s21c1
Sequence:CCGGCAGTTCACCATTTGCATTATACTCGAGTATAATGCAAATGGTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1042s1c1
Sequence:CCGGCAGTTCACCATTTGCATTATACTCGAGTATAATGCAAATGGTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-877s1c1
Sequence:CCGGCCAGGATACTTGAGGTAAGAACTCGAGTTCTTACCTCAAGTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1305s1c1
Sequence:CCGGGCTGATAAGAAGGGCCTCCATCTCGAGATGGAGGCCCTTCTTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1472s1c1
Sequence:CCGGGCGCTCTGTGTGGTCTAATTTCTCGAGAAATTAGACCACACAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-460s1c1
Sequence:CCGGGCCAGCAGTATAGACCATATACTCGAGTATATGGTCTATACTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031902
VALIDATED
MRPS5 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-609s21c1
Sequence:CCGGATCATTGGTGAAGGGCGTTATCTCGAGATAACGCCCTTCACCAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-877s21c1
Sequence:CCGGCCAGGATACTTGAGGTAAGAACTCGAGTTCTTACCTCAAGTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-1220s21c1
Sequence:CCGGCAAGGTCTCTGGGTCCATTAACTCGAGTTAATGGACCCAGAGACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-460s21c1
Sequence:CCGGGCCAGCAGTATAGACCATATACTCGAGTATATGGTCTATACTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031902.3-1042s21c1
Sequence:CCGGCAGTTCACCATTTGCATTATACTCGAGTATAATGCAAATGGTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1042s1c1
Sequence:CCGGCAGTTCACCATTTGCATTATACTCGAGTATAATGCAAATGGTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-877s1c1
Sequence:CCGGCCAGGATACTTGAGGTAAGAACTCGAGTTCTTACCTCAAGTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1305s1c1
Sequence:CCGGGCTGATAAGAAGGGCCTCCATCTCGAGATGGAGGCCCTTCTTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-1472s1c1
Sequence:CCGGGCGCTCTGTGTGGTCTAATTTCTCGAGAAATTAGACCACACAGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_031902.3-460s1c1
Sequence:CCGGGCCAGCAGTATAGACCATATACTCGAGTATATGGTCTATACTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029963
VALIDATED
MRPS5 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-297s21c1
Sequence:CCGGGAGCTCTGGAAAGGCGCATTACTCGAGTAATGCGCCTTTCCAGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-77s21c1
Sequence:CCGGGCAACTCTCTTTAAACGCCTTCTCGAGAAGGCGTTTAAAGAGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029963.2-1262s21c1
Sequence:CCGGGCGCTCTGTGTGGTTTAATTTCTCGAGAAATTAAACCACACAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029963.2-846s21c1
Sequence:CCGGCATTACATAGAACGATACGAACTCGAGTTCGTATCGTTCTATGTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-806s21c1
Sequence:CCGGCGCTTTCAGAAAGGCAAAGAACTCGAGTTCTTTGCCTTTCTGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-846s1c1
Sequence:CCGGCATTACATAGAACGATACGAACTCGAGTTCGTATCGTTCTATGTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-806s1c1
Sequence:CCGGCGCTTTCAGAAAGGCAAAGAACTCGAGTTCTTTGCCTTTCTGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-1262s1c1
Sequence:CCGGGCGCTCTGTGTGGTTTAATTTCTCGAGAAATTAAACCACACAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029963.2-667s1c1
Sequence:CCGGCCAGGATTCTTGAGGTAAGAACTCGAGTTCTTACCTCAAGAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-77s1c1
Sequence:CCGGGCAACTCTCTTTAAACGCCTTCTCGAGAAGGCGTTTAAAGAGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029963
VALIDATED
MRPS5 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-297s21c1
Sequence:CCGGGAGCTCTGGAAAGGCGCATTACTCGAGTAATGCGCCTTTCCAGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-77s21c1
Sequence:CCGGGCAACTCTCTTTAAACGCCTTCTCGAGAAGGCGTTTAAAGAGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029963.2-1262s21c1
Sequence:CCGGGCGCTCTGTGTGGTTTAATTTCTCGAGAAATTAAACCACACAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029963.2-846s21c1
Sequence:CCGGCATTACATAGAACGATACGAACTCGAGTTCGTATCGTTCTATGTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-806s21c1
Sequence:CCGGCGCTTTCAGAAAGGCAAAGAACTCGAGTTCTTTGCCTTTCTGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-846s1c1
Sequence:CCGGCATTACATAGAACGATACGAACTCGAGTTCGTATCGTTCTATGTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-806s1c1
Sequence:CCGGCGCTTTCAGAAAGGCAAAGAACTCGAGTTCTTTGCCTTTCTGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-1262s1c1
Sequence:CCGGGCGCTCTGTGTGGTTTAATTTCTCGAGAAATTAAACCACACAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029963.2-667s1c1
Sequence:CCGGCCAGGATTCTTGAGGTAAGAACTCGAGTTCTTACCTCAAGAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-77s1c1
Sequence:CCGGGCAACTCTCTTTAAACGCCTTCTCGAGAAGGCGTTTAAAGAGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029963
VALIDATED
MRPS5 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-297s21c1
Sequence:CCGGGAGCTCTGGAAAGGCGCATTACTCGAGTAATGCGCCTTTCCAGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-77s21c1
Sequence:CCGGGCAACTCTCTTTAAACGCCTTCTCGAGAAGGCGTTTAAAGAGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029963.2-1262s21c1
Sequence:CCGGGCGCTCTGTGTGGTTTAATTTCTCGAGAAATTAAACCACACAGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029963.2-846s21c1
Sequence:CCGGCATTACATAGAACGATACGAACTCGAGTTCGTATCGTTCTATGTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029963.2-806s21c1
Sequence:CCGGCGCTTTCAGAAAGGCAAAGAACTCGAGTTCTTTGCCTTTCTGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-846s1c1
Sequence:CCGGCATTACATAGAACGATACGAACTCGAGTTCGTATCGTTCTATGTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-806s1c1
Sequence:CCGGCGCTTTCAGAAAGGCAAAGAACTCGAGTTCTTTGCCTTTCTGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-1262s1c1
Sequence:CCGGGCGCTCTGTGTGGTTTAATTTCTCGAGAAATTAAACCACACAGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029963.2-667s1c1
Sequence:CCGGCCAGGATTCTTGAGGTAAGAACTCGAGTTCTTACCTCAAGAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029963.2-77s1c1
Sequence:CCGGGCAACTCTCTTTAAACGCCTTCTCGAGAAGGCGTTTAAAGAGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)