EMAIL THIS PAGE TO A FRIEND

MRPS6

mitochondrial ribosomal protein S6

47 Gene Product Result for
Synonyms: C21orf101 MRP-S6 RPMS6 S6mt
UniProtKB ID: P82932, B2R573, Q96Q64, Q9BSK8, Q9BW89
Gene ID:
Human(64968) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S6P family. Pseudogenes corresponding to this gene are found on chromosomes 1p and 12q. [provided by RefSeq, Jul 2008]
Mouse(121022) mitochondrial ribosomal protein S6
Rat(288253) mitochondrial ribosomal protein S6
Zebrafish(751746) mitochondrial ribosomal protein S6
cow(615431) mitochondrial ribosomal protein S6
domestic cat(101088510) mitochondrial ribosomal protein S6
dog(609947) mitochondrial ribosomal protein S6
chicken(427978) mitochondrial ribosomal protein S6
fruit fly(38535) mitochondrial ribosomal protein S6
domestic guinea pig(100728289) mitochondrial ribosomal protein S6
naked mole-rat(101727633) mitochondrial ribosomal protein S6
sheep(101120370) mitochondrial ribosomal protein S6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032476 Rosetta Predictions human pricing
NM_080456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203312 predicted 540
2 SASI_Hs01_00203313 predicted 415
3 SASI_Hs01_00203314 predicted 434
4 SASI_Hs01_00203317 predicted 255
5 SASI_Hs01_00203318 predicted 552
6 SASI_Hs01_00203319 predicted 463
7 SASI_Hs01_00203320 predicted 444
8 SASI_Hs02_00359924 predicted 425
9 SASI_Hs02_00359925 predicted 756
10 SASI_Hs02_00359926 predicted 318
11 SASI_Hs01_00203311 predicted 766
12 SASI_Hs01_00203315 predicted 765
13 SASI_Hs01_00203316 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196449 predicted 523
2 SASI_Mm01_00196450 predicted 359
3 SASI_Mm01_00196451 predicted 482
4 SASI_Mm01_00196452 predicted 468
5 SASI_Mm01_00196454 predicted 491
6 SASI_Mm01_00196455 predicted 311
7 SASI_Mm01_00196456 predicted 352
8 SASI_Mm01_00196457 predicted 516
9 SASI_Mm01_00196458 predicted 305
10 SASI_Mm02_00338117 predicted 195
11 SASI_Mm01_00196453 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080456
VALIDATED
MRPS6 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-326s1c1
Sequence:CCGGGAGAACATACTGGAACACTTGCTCGAGCAAGTGTTCCAGTATGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-156s1c1
Sequence:CCGGCTGCTGCTTTGAAACGTACAACTCGAGTTGTACGTTTCAAAGCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-200s1c1
Sequence:CCGGGCCATAGTGAGGAACTTGGAACTCGAGTTCCAAGTTCCTCACTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-315s21c1
Sequence:CCGGCAAGTGCTGTGGAGAACATACCTCGAGGTATGTTCTCCACAGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080456.1-486s1c1
Sequence:CCGGCACCAGATTCTGGCCTTATATCTCGAGATATAAGGCCAGAATCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-538s21c1
Sequence:CCGGGTTGTTGTCTAGGATACTTTACTCGAGTAAAGTATCCTAGACAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-158s21c1
Sequence:CCGGGCTGCTTTGAAACGTACAATACTCGAGTATTGTACGTTTCAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-283s21c1
Sequence:CCGGAGGGTATTTCCTGGTGGATTTCTCGAGAAATCCACCAGGAAATACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-358s21c1
Sequence:CCGGTGACGTGGTTAGACCAAATATCTCGAGATATTTGGTCTAACCACGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080456
VALIDATED
MRPS6 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-326s1c1
Sequence:CCGGGAGAACATACTGGAACACTTGCTCGAGCAAGTGTTCCAGTATGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-156s1c1
Sequence:CCGGCTGCTGCTTTGAAACGTACAACTCGAGTTGTACGTTTCAAAGCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-200s1c1
Sequence:CCGGGCCATAGTGAGGAACTTGGAACTCGAGTTCCAAGTTCCTCACTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-315s21c1
Sequence:CCGGCAAGTGCTGTGGAGAACATACCTCGAGGTATGTTCTCCACAGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080456.1-486s1c1
Sequence:CCGGCACCAGATTCTGGCCTTATATCTCGAGATATAAGGCCAGAATCTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-538s21c1
Sequence:CCGGGTTGTTGTCTAGGATACTTTACTCGAGTAAAGTATCCTAGACAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-158s21c1
Sequence:CCGGGCTGCTTTGAAACGTACAATACTCGAGTATTGTACGTTTCAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-283s21c1
Sequence:CCGGAGGGTATTTCCTGGTGGATTTCTCGAGAAATCCACCAGGAAATACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-358s21c1
Sequence:CCGGTGACGTGGTTAGACCAAATATCTCGAGATATTTGGTCTAACCACGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080456
VALIDATED
MRPS6 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-326s1c1
Sequence:CCGGGAGAACATACTGGAACACTTGCTCGAGCAAGTGTTCCAGTATGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-156s1c1
Sequence:CCGGCTGCTGCTTTGAAACGTACAACTCGAGTTGTACGTTTCAAAGCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080456.1-200s1c1
Sequence:CCGGGCCATAGTGAGGAACTTGGAACTCGAGTTCCAAGTTCCTCACTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-315s21c1
Sequence:CCGGCAAGTGCTGTGGAGAACATACCTCGAGGTATGTTCTCCACAGCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080456.1-486s1c1
Sequence:CCGGCACCAGATTCTGGCCTTATATCTCGAGATATAAGGCCAGAATCTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-538s21c1
Sequence:CCGGGTTGTTGTCTAGGATACTTTACTCGAGTAAAGTATCCTAGACAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-158s21c1
Sequence:CCGGGCTGCTTTGAAACGTACAATACTCGAGTATTGTACGTTTCAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-283s21c1
Sequence:CCGGAGGGTATTTCCTGGTGGATTTCTCGAGAAATCCACCAGGAAATACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080456.1-358s21c1
Sequence:CCGGTGACGTGGTTAGACCAAATATCTCGAGATATTTGGTCTAACCACGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032476
VALIDATED
MRPS6 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S6
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-314s1c1
Sequence:CCGGGCGCTTCCTTATAGGATCTCTCTCGAGAGAGATCCTATAAGGAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-278s1c1
Sequence:CCGGGCAATAGTGAGGGACTTGGAACTCGAGTTCCAAGTCCCTCACTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032476.2-742s1c1
Sequence:CCGGGCTTCTCTGTAACCTGCAGTACTCGAGTACTGCAGGTTACAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-361s1c1
Sequence:CCGGCGGGTATTTCTTGGTGGATTTCTCGAGAAATCCACCAAGAAATACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-488s1c1
Sequence:CCGGGAATGTGAAGGGATTGTCCCACTCGAGTGGGACAATCCCTTCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-264s21c1
Sequence:CCGGTGATGGACAGAGGAGCAATAGCTCGAGCTATTGCTCCTCTGTCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-236s21c1
Sequence:CCGGGCTACTTTGAAACGTACGATACTCGAGTATCGTACGTTTCAAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-247s21c1
Sequence:CCGGACGTACGATAGAGGCCCTGATCTCGAGATCAGGGCCTCTATCGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-553s21c1
Sequence:CCGGGTGAGAAGATTCGCCAGATTTCTCGAGAAATCTGGCGAATCTTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-438s21c1
Sequence:CCGGATGTGATTAGAGGGAATATTGCTCGAGCAATATTCCCTCTAATCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-628s21c1
Sequence:CCGGTTGCAAGTTTGGCCTTTATATCTCGAGATATAAAGGCCAAACTTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-224s21c1
Sequence:CCGGCCAGAGACTGCTGCTACTTTGCTCGAGCAAAGTAGCAGCAGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-466s21c1
Sequence:CCGGCCCTCTGACCCAGGAACTAAACTCGAGTTTAGTTCCTGGGTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-657s21c1
Sequence:CCGGGTTGCAGGTGCTGTTTGATTTCTCGAGAAATCAAACAGCACCTGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-427s21c1
Sequence:CCGGTCGAGATATAGATGTGATTAGCTCGAGCTAATCACATCTATATCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032476
VALIDATED
MRPS6 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S6
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-314s1c1
Sequence:CCGGGCGCTTCCTTATAGGATCTCTCTCGAGAGAGATCCTATAAGGAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-278s1c1
Sequence:CCGGGCAATAGTGAGGGACTTGGAACTCGAGTTCCAAGTCCCTCACTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032476.2-742s1c1
Sequence:CCGGGCTTCTCTGTAACCTGCAGTACTCGAGTACTGCAGGTTACAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-361s1c1
Sequence:CCGGCGGGTATTTCTTGGTGGATTTCTCGAGAAATCCACCAAGAAATACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-488s1c1
Sequence:CCGGGAATGTGAAGGGATTGTCCCACTCGAGTGGGACAATCCCTTCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-264s21c1
Sequence:CCGGTGATGGACAGAGGAGCAATAGCTCGAGCTATTGCTCCTCTGTCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-236s21c1
Sequence:CCGGGCTACTTTGAAACGTACGATACTCGAGTATCGTACGTTTCAAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-247s21c1
Sequence:CCGGACGTACGATAGAGGCCCTGATCTCGAGATCAGGGCCTCTATCGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-553s21c1
Sequence:CCGGGTGAGAAGATTCGCCAGATTTCTCGAGAAATCTGGCGAATCTTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-438s21c1
Sequence:CCGGATGTGATTAGAGGGAATATTGCTCGAGCAATATTCCCTCTAATCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-628s21c1
Sequence:CCGGTTGCAAGTTTGGCCTTTATATCTCGAGATATAAAGGCCAAACTTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-224s21c1
Sequence:CCGGCCAGAGACTGCTGCTACTTTGCTCGAGCAAAGTAGCAGCAGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-466s21c1
Sequence:CCGGCCCTCTGACCCAGGAACTAAACTCGAGTTTAGTTCCTGGGTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-657s21c1
Sequence:CCGGGTTGCAGGTGCTGTTTGATTTCTCGAGAAATCAAACAGCACCTGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-427s21c1
Sequence:CCGGTCGAGATATAGATGTGATTAGCTCGAGCTAATCACATCTATATCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032476
VALIDATED
MRPS6 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S6
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-314s1c1
Sequence:CCGGGCGCTTCCTTATAGGATCTCTCTCGAGAGAGATCCTATAAGGAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-278s1c1
Sequence:CCGGGCAATAGTGAGGGACTTGGAACTCGAGTTCCAAGTCCCTCACTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032476.2-742s1c1
Sequence:CCGGGCTTCTCTGTAACCTGCAGTACTCGAGTACTGCAGGTTACAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-361s1c1
Sequence:CCGGCGGGTATTTCTTGGTGGATTTCTCGAGAAATCCACCAAGAAATACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032476.2-488s1c1
Sequence:CCGGGAATGTGAAGGGATTGTCCCACTCGAGTGGGACAATCCCTTCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-264s21c1
Sequence:CCGGTGATGGACAGAGGAGCAATAGCTCGAGCTATTGCTCCTCTGTCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-236s21c1
Sequence:CCGGGCTACTTTGAAACGTACGATACTCGAGTATCGTACGTTTCAAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-247s21c1
Sequence:CCGGACGTACGATAGAGGCCCTGATCTCGAGATCAGGGCCTCTATCGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-553s21c1
Sequence:CCGGGTGAGAAGATTCGCCAGATTTCTCGAGAAATCTGGCGAATCTTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-438s21c1
Sequence:CCGGATGTGATTAGAGGGAATATTGCTCGAGCAATATTCCCTCTAATCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-628s21c1
Sequence:CCGGTTGCAAGTTTGGCCTTTATATCTCGAGATATAAAGGCCAAACTTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-224s21c1
Sequence:CCGGCCAGAGACTGCTGCTACTTTGCTCGAGCAAAGTAGCAGCAGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-466s21c1
Sequence:CCGGCCCTCTGACCCAGGAACTAAACTCGAGTTTAGTTCCTGGGTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-657s21c1
Sequence:CCGGGTTGCAGGTGCTGTTTGATTTCTCGAGAAATCAAACAGCACCTGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032476.3-427s21c1
Sequence:CCGGTCGAGATATAGATGTGATTAGCTCGAGCTAATCACATCTATATCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)