EMAIL THIS PAGE TO A FRIEND

MRPS9

mitochondrial ribosomal protein S9

53 Gene Product Result for
Synonyms: MRP-S9 RPMS9 S9mt
UniProtKB ID: P82933, Q6PG40
Gene ID:
Human(64965) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]
Mouse(69527) mitochondrial ribosomal protein S9
Rat(301371) mitochondrial ribosomal protein S9
Zebrafish(751681) mitochondrial ribosomal protein S9
fruit fly(40932) mitochondrial ribosomal protein S9
chicken(418723) mitochondrial ribosomal protein S9
cow(519302) mitochondrial ribosomal protein S9
domestic cat(101101126) mitochondrial ribosomal protein S9
dog(474545) mitochondrial ribosomal protein S9
domestic guinea pig(100728248) mitochondrial ribosomal protein S9
naked mole-rat(101717276) mitochondrial ribosomal protein S9
sheep(101102050) mitochondrial ribosomal protein S9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182640 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182640 Rosetta Predictions human pricing
NM_001100549 Rosetta Predictions rat pricing
NM_023514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129226 predicted 564
2 SASI_Hs01_00129227 predicted 662
3 SASI_Hs02_00370791 predicted 202
4 SASI_Hs02_00370792 predicted 214
5 SASI_Hs01_00129229 predicted 1154
6 SASI_Hs01_00129230 predicted 1001
7 SASI_Hs02_00370793 predicted 203
8 SASI_Hs01_00129231 predicted 480
9 SASI_Hs01_00129232 predicted 527
10 SASI_Hs01_00129233 predicted 260
11 SASI_Hs01_00129228 predicted 282
12 SASI_Hs01_00129234 predicted 519
13 SASI_Hs01_00129235 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210028 predicted 527
2 SASI_Rn02_00210029 predicted 780
3 SASI_Rn02_00210030 predicted 914
4 SASI_Rn02_00210031 predicted 1058
5 SASI_Rn02_00210032 predicted 219
6 SASI_Rn02_00210033 predicted 313
7 SASI_Rn02_00210034 predicted 256
8 SASI_Rn02_00210035 predicted 496
9 SASI_Rn02_00210036 predicted 401
10 SASI_Rn02_00210037 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025043 predicted 283
2 SASI_Mm01_00025044 predicted 287
3 SASI_Mm01_00025045 predicted 801
4 SASI_Mm01_00025046 predicted 801
5 SASI_Mm01_00025047 predicted 520
6 SASI_Mm01_00025049 predicted 476
7 SASI_Mm01_00025048 predicted 675
8 SASI_Mm01_00025050 predicted 499
9 SASI_Mm02_00327160 predicted 238
10 SASI_Mm01_00025051 predicted 1018
11 SASI_Mm01_00025042 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023514
VALIDATED
MRPS9 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023514.2-725s1c1
Sequence:CCGGGCAGAAGTGTAACTATTCAATCTCGAGATTGAATAGTTACACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023514.2-498s1c1
Sequence:CCGGCGACGTGTATGGAAAGGTCATCTCGAGATGACCTTTCCATACACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-589s1c1
Sequence:CCGGCTGATTAAGGAGGAACTAGAACTCGAGTTCTAGTTCCTCCTTAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-313s1c1
Sequence:CCGGGAGGATATTGATAGAGCTATTCTCGAGAATAGCTCTATCAATATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-466s1c1
Sequence:CCGGACTGGCAAACAATCGTACTATCTCGAGATAGTACGATTGTTTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-363s21c1
Sequence:CCGGGAGGATATTGATAGAGCTATTCTCGAGAATAGCTCTATCAATATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-516s21c1
Sequence:CCGGACTGGCAAACAATCGTACTATCTCGAGATAGTACGATTGTTTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-548s21c1
Sequence:CCGGCGACGTGTATGGAAAGGTCATCTCGAGATGACCTTTCCATACACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-775s21c1
Sequence:CCGGGCAGAAGTGTAACTATTCAATCTCGAGATTGAATAGTTACACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023514
VALIDATED
MRPS9 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023514.2-725s1c1
Sequence:CCGGGCAGAAGTGTAACTATTCAATCTCGAGATTGAATAGTTACACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023514.2-498s1c1
Sequence:CCGGCGACGTGTATGGAAAGGTCATCTCGAGATGACCTTTCCATACACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-589s1c1
Sequence:CCGGCTGATTAAGGAGGAACTAGAACTCGAGTTCTAGTTCCTCCTTAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-313s1c1
Sequence:CCGGGAGGATATTGATAGAGCTATTCTCGAGAATAGCTCTATCAATATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-466s1c1
Sequence:CCGGACTGGCAAACAATCGTACTATCTCGAGATAGTACGATTGTTTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-363s21c1
Sequence:CCGGGAGGATATTGATAGAGCTATTCTCGAGAATAGCTCTATCAATATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-516s21c1
Sequence:CCGGACTGGCAAACAATCGTACTATCTCGAGATAGTACGATTGTTTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-548s21c1
Sequence:CCGGCGACGTGTATGGAAAGGTCATCTCGAGATGACCTTTCCATACACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-775s21c1
Sequence:CCGGGCAGAAGTGTAACTATTCAATCTCGAGATTGAATAGTTACACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023514
VALIDATED
MRPS9 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023514.2-725s1c1
Sequence:CCGGGCAGAAGTGTAACTATTCAATCTCGAGATTGAATAGTTACACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023514.2-498s1c1
Sequence:CCGGCGACGTGTATGGAAAGGTCATCTCGAGATGACCTTTCCATACACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-589s1c1
Sequence:CCGGCTGATTAAGGAGGAACTAGAACTCGAGTTCTAGTTCCTCCTTAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-313s1c1
Sequence:CCGGGAGGATATTGATAGAGCTATTCTCGAGAATAGCTCTATCAATATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023514.2-466s1c1
Sequence:CCGGACTGGCAAACAATCGTACTATCTCGAGATAGTACGATTGTTTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-363s21c1
Sequence:CCGGGAGGATATTGATAGAGCTATTCTCGAGAATAGCTCTATCAATATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-516s21c1
Sequence:CCGGACTGGCAAACAATCGTACTATCTCGAGATAGTACGATTGTTTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-548s21c1
Sequence:CCGGCGACGTGTATGGAAAGGTCATCTCGAGATGACCTTTCCATACACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023514.4-775s21c1
Sequence:CCGGGCAGAAGTGTAACTATTCAATCTCGAGATTGAATAGTTACACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182640
MRPS9 MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosomal protein S9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182640.1-1266s1c1
Sequence:CCGGGCTATATATATGTGCCGACATCTCGAGATGTCGGCACATATATATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-331s1c1
Sequence:CCGGCCAGAAACTTTCACTCAAGAACTCGAGTTCTTGAGTGAAAGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-477s1c1
Sequence:CCGGCCGTCCATTTCACTATCTCTTCTCGAGAAGAGATAGTGAAATGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-1144s1c1
Sequence:CCGGGCTGGACTACTTACTACTGATCTCGAGATCAGTAGTAAGTAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-779s1c1
Sequence:CCGGGAAGAAGTGTAACTCTTGAATCTCGAGATTCAAGAGTTACACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-704s21c1
Sequence:CCGGACTGTCAGATCTAGATTATATCTCGAGATATAATCTAGATCTGACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-313s21c1
Sequence:CCGGACATAGGAAAGAGACATTTAGCTCGAGCTAAATGTCTCTTTCCTATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-210s21c1
Sequence:CCGGAGGCTAAGACATACTGCATTTCTCGAGAAATGCAGTATGTCTTAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-634s21c1
Sequence:CCGGCTGTAACCAGAGACGTGATTGCTCGAGCAATCACGTCTCTGGTTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182640
MRPS9 MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosomal protein S9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182640.1-1266s1c1
Sequence:CCGGGCTATATATATGTGCCGACATCTCGAGATGTCGGCACATATATATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-331s1c1
Sequence:CCGGCCAGAAACTTTCACTCAAGAACTCGAGTTCTTGAGTGAAAGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-477s1c1
Sequence:CCGGCCGTCCATTTCACTATCTCTTCTCGAGAAGAGATAGTGAAATGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-1144s1c1
Sequence:CCGGGCTGGACTACTTACTACTGATCTCGAGATCAGTAGTAAGTAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-779s1c1
Sequence:CCGGGAAGAAGTGTAACTCTTGAATCTCGAGATTCAAGAGTTACACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-704s21c1
Sequence:CCGGACTGTCAGATCTAGATTATATCTCGAGATATAATCTAGATCTGACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-313s21c1
Sequence:CCGGACATAGGAAAGAGACATTTAGCTCGAGCTAAATGTCTCTTTCCTATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-210s21c1
Sequence:CCGGAGGCTAAGACATACTGCATTTCTCGAGAAATGCAGTATGTCTTAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-634s21c1
Sequence:CCGGCTGTAACCAGAGACGTGATTGCTCGAGCAATCACGTCTCTGGTTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182640
MRPS9 MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosomal protein S9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182640.1-1266s1c1
Sequence:CCGGGCTATATATATGTGCCGACATCTCGAGATGTCGGCACATATATATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-331s1c1
Sequence:CCGGCCAGAAACTTTCACTCAAGAACTCGAGTTCTTGAGTGAAAGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-477s1c1
Sequence:CCGGCCGTCCATTTCACTATCTCTTCTCGAGAAGAGATAGTGAAATGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-1144s1c1
Sequence:CCGGGCTGGACTACTTACTACTGATCTCGAGATCAGTAGTAAGTAGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182640.1-779s1c1
Sequence:CCGGGAAGAAGTGTAACTCTTGAATCTCGAGATTCAAGAGTTACACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-704s21c1
Sequence:CCGGACTGTCAGATCTAGATTATATCTCGAGATATAATCTAGATCTGACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-313s21c1
Sequence:CCGGACATAGGAAAGAGACATTTAGCTCGAGCTAAATGTCTCTTTCCTATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-210s21c1
Sequence:CCGGAGGCTAAGACATACTGCATTTCTCGAGAAATGCAGTATGTCTTAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182640.2-634s21c1
Sequence:CCGGCTGTAACCAGAGACGTGATTGCTCGAGCAATCACGTCTCTGGTTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)