EMAIL THIS PAGE TO A FRIEND

MRRF

mitochondrial ribosome recycling factor

126 Gene Product Result for
Synonyms: MRFF MTRRF RRF
Gene ID:
Mouse(67871) mitochondrial ribosome recycling factor
Rat(311903) mitochondrial ribosome recycling factor
Zebrafish(431721) mitochondrial ribosome recycling factor
cow(614013) mitochondrial ribosome recycling factor
domestic cat(101092304) mitochondrial ribosome recycling factor
dog(480739) mitochondrial ribosome recycling factor
chicken(417110) mitochondrial ribosome recycling factor
sheep(101113216) mitochondrial ribosome recycling factor
naked mole-rat(101699928) mitochondrial ribosome recycling factor
domestic guinea pig(100717933) mitochondrial ribosome recycling factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138777 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138777 Rosetta Predictions human pricing
NM_199177 Rosetta Predictions human pricing
NM_001008354 Rosetta Predictions rat pricing
NM_026422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060194 predicted 197
2 SASI_Hs01_00060195 predicted 1135
3 SASI_Hs01_00060197 predicted 1145
4 SASI_Hs01_00060198 predicted 399
5 SASI_Hs01_00060199 predicted 1176
6 SASI_Hs01_00060201 predicted 235
7 SASI_Hs01_00060202 predicted 339
8 SASI_Hs01_00060203 predicted 1026
9 SASI_Hs02_00363897 predicted 335
10 SASI_Hs02_00363898 predicted 206
11 SASI_Hs01_00060196 predicted 1060
12 SASI_Hs01_00060200 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090429 predicted 202
2 SASI_Hs01_00090430 predicted 972
3 SASI_Hs01_00090432 predicted 986
4 SASI_Hs01_00090433 predicted 406
5 SASI_Hs01_00090434 predicted 1023
6 SASI_Hs01_00090436 predicted 227
7 SASI_Hs01_00090437 predicted 340
8 SASI_Hs01_00090438 predicted 864
9 SASI_Hs02_00372613 predicted 336
10 SASI_Hs02_00372614 predicted 204
11 SASI_Hs01_00090431 predicted 904
12 SASI_Hs01_00090435 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199109 predicted 466
2 SASI_Rn02_00199110 predicted 674
3 SASI_Rn02_00199111 predicted 675
4 SASI_Rn01_00064704 predicted 823
5 SASI_Rn01_00064705 predicted 325
6 SASI_Rn01_00064706 predicted 338
7 SASI_Rn02_00199112 predicted 624
8 SASI_Rn02_00199113 predicted 816
9 SASI_Rn02_00199114 predicted 524
10 SASI_Rn02_00199115 predicted 571
11 SASI_Rn01_00064703 predicted 819
12 SASI_Rn01_00064707 predicted 327
13 SASI_Rn01_00064708 predicted 347
14 SASI_Rn01_00064709 predicted 474
15 SASI_Rn01_00064710 predicted 269
16 SASI_Rn01_00064711 predicted 438
17 SASI_Rn01_00064712 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098343 predicted 350
2 SASI_Mm01_00098344 predicted 684
3 SASI_Mm01_00098345 predicted 694
4 SASI_Mm01_00098346 predicted 696
5 SASI_Mm01_00098347 predicted 828
6 SASI_Mm02_00330235 predicted 327
7 SASI_Mm01_00098349 predicted 837
8 SASI_Mm01_00098350 predicted 538
9 SASI_Mm01_00098351 predicted 437
10 SASI_Mm01_00098352 predicted 744
11 SASI_Mm01_00098348 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138777
VALIDATED
MRRF MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosome recycling factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138777.2-341s21c1
Sequence:CCGGGCTGCCTTGGTTGAGGATATACTCGAGTATATCCTCAACCAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-742s21c1
Sequence:CCGGGAAGGTTCGCACCAACTCAATCTCGAGATTGAGTTGGTGCGAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-679s21c1
Sequence:CCGGGCACAGAGAAATGCTGGTGAACTCGAGTTCACCAGCATTTCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-204s21c1
Sequence:CCGGCACTGAAGACAGTGCATGAAACTCGAGTTTCATGCACTGTCTTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138777.2-162s21c1
Sequence:CCGGGCAATTATCTTGCAGCCTCTACTCGAGTAGAGGCTGCAAGATAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-204s1c1
Sequence:CCGGCACTGAAGACAGTGCATGAAACTCGAGTTTCATGCACTGTCTTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-162s1c1
Sequence:CCGGGCAATTATCTTGCAGCCTCTACTCGAGTAGAGGCTGCAAGATAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-341s1c1
Sequence:CCGGGCTGCCTTGGTTGAGGATATACTCGAGTATATCCTCAACCAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138777.2-742s1c1
Sequence:CCGGGAAGGTTCGCACCAACTCAATCTCGAGATTGAGTTGGTGCGAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-679s1c1
Sequence:CCGGGCACAGAGAAATGCTGGTGAACTCGAGTTCACCAGCATTTCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138777
VALIDATED
MRRF MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosome recycling factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138777.2-341s21c1
Sequence:CCGGGCTGCCTTGGTTGAGGATATACTCGAGTATATCCTCAACCAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-742s21c1
Sequence:CCGGGAAGGTTCGCACCAACTCAATCTCGAGATTGAGTTGGTGCGAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-679s21c1
Sequence:CCGGGCACAGAGAAATGCTGGTGAACTCGAGTTCACCAGCATTTCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-204s21c1
Sequence:CCGGCACTGAAGACAGTGCATGAAACTCGAGTTTCATGCACTGTCTTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138777.2-162s21c1
Sequence:CCGGGCAATTATCTTGCAGCCTCTACTCGAGTAGAGGCTGCAAGATAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-204s1c1
Sequence:CCGGCACTGAAGACAGTGCATGAAACTCGAGTTTCATGCACTGTCTTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-162s1c1
Sequence:CCGGGCAATTATCTTGCAGCCTCTACTCGAGTAGAGGCTGCAAGATAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-341s1c1
Sequence:CCGGGCTGCCTTGGTTGAGGATATACTCGAGTATATCCTCAACCAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138777.2-742s1c1
Sequence:CCGGGAAGGTTCGCACCAACTCAATCTCGAGATTGAGTTGGTGCGAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-679s1c1
Sequence:CCGGGCACAGAGAAATGCTGGTGAACTCGAGTTCACCAGCATTTCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138777
VALIDATED
MRRF MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosome recycling factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138777.2-341s21c1
Sequence:CCGGGCTGCCTTGGTTGAGGATATACTCGAGTATATCCTCAACCAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-742s21c1
Sequence:CCGGGAAGGTTCGCACCAACTCAATCTCGAGATTGAGTTGGTGCGAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-679s21c1
Sequence:CCGGGCACAGAGAAATGCTGGTGAACTCGAGTTCACCAGCATTTCTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_138777.2-204s21c1
Sequence:CCGGCACTGAAGACAGTGCATGAAACTCGAGTTTCATGCACTGTCTTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138777.2-162s21c1
Sequence:CCGGGCAATTATCTTGCAGCCTCTACTCGAGTAGAGGCTGCAAGATAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-204s1c1
Sequence:CCGGCACTGAAGACAGTGCATGAAACTCGAGTTTCATGCACTGTCTTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-162s1c1
Sequence:CCGGGCAATTATCTTGCAGCCTCTACTCGAGTAGAGGCTGCAAGATAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-341s1c1
Sequence:CCGGGCTGCCTTGGTTGAGGATATACTCGAGTATATCCTCAACCAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138777.2-742s1c1
Sequence:CCGGGAAGGTTCGCACCAACTCAATCTCGAGATTGAGTTGGTGCGAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138777.2-679s1c1
Sequence:CCGGGCACAGAGAAATGCTGGTGAACTCGAGTTCACCAGCATTTCTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026422
MRRF MISSION shRNA Bacterial Glycerol Stock
mitochondrial ribosome recycling factor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-683s21c1
Sequence:CCGGTTACGGAAGGTTCGCACTAATCTCGAGATTAGTGCGAACCTTCCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026422.1-370s1c1
Sequence:CCGGCAATAAGACTCTCAACATAAGCTCGAGCTTATGTTGAGAGTCTTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-529s21c1
Sequence:CCGGTGCAGCTATCAAGGCTATAAGCTCGAGCTTATAGCCTTGATAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026422.1-1244s21c1
Sequence:CCGGGCTGATGATCAAGCCTAAATACTCGAGTATTTAGGCTTGATCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-267s21c1
Sequence:CCGGAGGCCAGGGTGACCGTTAATACTCGAGTATTAACGGTCACCCTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-399s21c1
Sequence:CCGGCAGGATCCCTTGATCATATTACTCGAGTAATATGATCAAGGGATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026422.1-1196s1c1
Sequence:CCGGGCCCTTGTGTTAAACTCATTTCTCGAGAAATGAGTTTAACACAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026422.1-1167s1c1
Sequence:CCGGGCCTCCTTTCAAACTGTGAATCTCGAGATTCACAGTTTGAAAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026422
MRRF MISSION shRNA shRNA Plasmid DNA
mitochondrial ribosome recycling factor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-683s21c1
Sequence:CCGGTTACGGAAGGTTCGCACTAATCTCGAGATTAGTGCGAACCTTCCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026422.1-370s1c1
Sequence:CCGGCAATAAGACTCTCAACATAAGCTCGAGCTTATGTTGAGAGTCTTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-529s21c1
Sequence:CCGGTGCAGCTATCAAGGCTATAAGCTCGAGCTTATAGCCTTGATAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026422.1-1244s21c1
Sequence:CCGGGCTGATGATCAAGCCTAAATACTCGAGTATTTAGGCTTGATCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-267s21c1
Sequence:CCGGAGGCCAGGGTGACCGTTAATACTCGAGTATTAACGGTCACCCTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-399s21c1
Sequence:CCGGCAGGATCCCTTGATCATATTACTCGAGTAATATGATCAAGGGATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026422.1-1196s1c1
Sequence:CCGGGCCCTTGTGTTAAACTCATTTCTCGAGAAATGAGTTTAACACAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026422.1-1167s1c1
Sequence:CCGGGCCTCCTTTCAAACTGTGAATCTCGAGATTCACAGTTTGAAAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026422
MRRF MISSION shRNA Lentiviral Transduction Particles
mitochondrial ribosome recycling factor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-683s21c1
Sequence:CCGGTTACGGAAGGTTCGCACTAATCTCGAGATTAGTGCGAACCTTCCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026422.1-370s1c1
Sequence:CCGGCAATAAGACTCTCAACATAAGCTCGAGCTTATGTTGAGAGTCTTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-529s21c1
Sequence:CCGGTGCAGCTATCAAGGCTATAAGCTCGAGCTTATAGCCTTGATAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026422.1-1244s21c1
Sequence:CCGGGCTGATGATCAAGCCTAAATACTCGAGTATTTAGGCTTGATCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-267s21c1
Sequence:CCGGAGGCCAGGGTGACCGTTAATACTCGAGTATTAACGGTCACCCTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026422.1-399s21c1
Sequence:CCGGCAGGATCCCTTGATCATATTACTCGAGTAATATGATCAAGGGATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026422.1-1196s1c1
Sequence:CCGGGCCCTTGTGTTAAACTCATTTCTCGAGAAATGAGTTTAACACAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026422.1-1167s1c1
Sequence:CCGGGCCTCCTTTCAAACTGTGAATCTCGAGATTCACAGTTTGAAAGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)