EMAIL THIS PAGE TO A FRIEND

MRS2

MRS2 magnesium transporter

49 Gene Product Result for
Synonyms: HPT MRS2L
Gene ID:
Mouse(380836) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
Rat(79032) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
chicken(420820) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
cow(508554) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
domestic cat(101088747) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
dog(488245) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
domestic guinea pig(100723813) MRS2 magnesium transporter
naked mole-rat(101725260) MRS2 magnesium transporter
Domestic Rabbit(100352085) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
Goat(100861264) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
sheep(101119262) MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020662 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU189941 MISSION® esiRNA esiRNA targeting mouse Mrs2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020662 Rosetta Predictions human pricing
NM_024001 Rosetta Predictions rat pricing
NM_001013389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182573 predicted 475
2 SASI_Hs01_00182574 predicted 315
3 SASI_Hs01_00182576 predicted 1066
4 SASI_Hs01_00182577 predicted 1215
5 SASI_Hs01_00182578 predicted 1060
6 SASI_Hs01_00182579 predicted 1068
7 SASI_Hs02_00353649 predicted 449
8 SASI_Hs01_00182580 predicted 497
9 SASI_Hs01_00182581 predicted 387
10 SASI_Hs02_00353650 predicted 646
11 SASI_Hs01_00182575 predicted 582
12 SASI_Hs01_00182582 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083217 predicted 496
2 SASI_Rn01_00083218 predicted 1034
3 SASI_Rn01_00083219 predicted 1296
4 SASI_Rn01_00083220 predicted 407
5 SASI_Rn01_00083221 predicted 767
6 SASI_Rn01_00083222 predicted 1135
7 SASI_Rn01_00083223 predicted 1102
8 SASI_Rn01_00083224 predicted 1299
9 SASI_Rn01_00083225 predicted 1006
10 SASI_Rn01_00083226 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091179 predicted 551
2 SASI_Mm01_00091180 predicted 1462
3 SASI_Mm01_00091181 predicted 826
4 SASI_Mm01_00091182 predicted 466
5 SASI_Mm01_00091183 predicted 1445
6 SASI_Mm01_00091184 predicted 1157
7 SASI_Mm01_00091185 predicted 1355
8 SASI_Mm02_00287219 predicted 562
9 SASI_Mm01_00091186 predicted 487
10 SASI_Mm02_00287220 predicted 587
11 SASI_Mm01_00091178 predicted 1108
12 SASI_Mm01_00091187 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013389
VALIDATED
MRS2 MISSION shRNA Bacterial Glycerol Stock
MRS2 magnesium transporter
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-520s1c1
Sequence:CCGGGAGTATTTGAAGGCTGTGATACTCGAGTATCACAGCCTTCAAATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013389.1-1855s1c1
Sequence:CCGGCGAAAGCTAATGGATCTGTTACTCGAGTAACAGATCCATTAGCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-1062s1c1
Sequence:CCGGCGATTCGCAGAGCATTATCTTCTCGAGAAGATAATGCTCTGCGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-367s1c1
Sequence:CCGGGCTGTGACAAAGTTTGACAAACTCGAGTTTGTCAAACTTTGTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-655s1c1
Sequence:CCGGCCATTTGAGTTCAGAGCTATTCTCGAGAATAGCTCTGAACTCAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-544s1c1
Sequence:CCGGCCAGAGTGTCTTCTGATACTACTCGAGTAGTATCAGAAGACACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-1104s1c1
Sequence:CCGGCAATGTGATGATGAGGTTAAACTCGAGTTTAACCTCATCATCACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-1327s1c1
Sequence:CCGGGTGATGACCTCCTTACCTAAACTCGAGTTTAGGTAAGGAGGTCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013389
VALIDATED
MRS2 MISSION shRNA shRNA Plasmid DNA
MRS2 magnesium transporter
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-520s1c1
Sequence:CCGGGAGTATTTGAAGGCTGTGATACTCGAGTATCACAGCCTTCAAATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013389.1-1855s1c1
Sequence:CCGGCGAAAGCTAATGGATCTGTTACTCGAGTAACAGATCCATTAGCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-1062s1c1
Sequence:CCGGCGATTCGCAGAGCATTATCTTCTCGAGAAGATAATGCTCTGCGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-367s1c1
Sequence:CCGGGCTGTGACAAAGTTTGACAAACTCGAGTTTGTCAAACTTTGTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-655s1c1
Sequence:CCGGCCATTTGAGTTCAGAGCTATTCTCGAGAATAGCTCTGAACTCAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-544s1c1
Sequence:CCGGCCAGAGTGTCTTCTGATACTACTCGAGTAGTATCAGAAGACACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-1104s1c1
Sequence:CCGGCAATGTGATGATGAGGTTAAACTCGAGTTTAACCTCATCATCACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-1327s1c1
Sequence:CCGGGTGATGACCTCCTTACCTAAACTCGAGTTTAGGTAAGGAGGTCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013389
VALIDATED
MRS2 MISSION shRNA Lentiviral Transduction Particles
MRS2 magnesium transporter
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-520s1c1
Sequence:CCGGGAGTATTTGAAGGCTGTGATACTCGAGTATCACAGCCTTCAAATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013389.1-1855s1c1
Sequence:CCGGCGAAAGCTAATGGATCTGTTACTCGAGTAACAGATCCATTAGCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-1062s1c1
Sequence:CCGGCGATTCGCAGAGCATTATCTTCTCGAGAAGATAATGCTCTGCGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-367s1c1
Sequence:CCGGGCTGTGACAAAGTTTGACAAACTCGAGTTTGTCAAACTTTGTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-655s1c1
Sequence:CCGGCCATTTGAGTTCAGAGCTATTCTCGAGAATAGCTCTGAACTCAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013389.1-544s1c1
Sequence:CCGGCCAGAGTGTCTTCTGATACTACTCGAGTAGTATCAGAAGACACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-1104s1c1
Sequence:CCGGCAATGTGATGATGAGGTTAAACTCGAGTTTAACCTCATCATCACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013389.1-1327s1c1
Sequence:CCGGGTGATGACCTCCTTACCTAAACTCGAGTTTAGGTAAGGAGGTCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020662
VALIDATED
MRS2 MISSION shRNA Bacterial Glycerol Stock
MRS2 magnesium transporter
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-311s21c1
Sequence:CCGGAGGTGAAGTGCACCGGTTTAGCTCGAGCTAAACCGGTGCACTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020662.2-2648s21c1
Sequence:CCGGTGTTACTCCCGTCGCTGATTTCTCGAGAAATCAGCGACGGGAGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1798s1c1
Sequence:CCGGCTTTGTCAGTATAGGGAATTACTCGAGTAATTCCCTATACTGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1348s1c1
Sequence:CCGGGATAGAAGCATGGAATTGAAACTCGAGTTTCAATTCCATGCTTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-522s21c1
Sequence:CCGGATCATGAGAATGGAGTATTTGCTCGAGCAAATACTCCATTCTCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-648s21c1
Sequence:GTACCGGCAACTCGTTACATACCCTTTACTCGAGTAAAGGGTATGTAACGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-342s1c1
Sequence:CCGGCCCAGTATTTACTGTGACAAACTCGAGTTTGTCACAGTAAATACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1404s1c1
Sequence:CCGGGAGCATCCTAACAAACCGTTACTCGAGTAACGGTTTGTTAGGATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-726s1c1
Sequence:CCGGCCTTGAGACCTTGGATGCTTTCTCGAGAAAGCATCCAAGGTCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020662.1-1394s1c1
Sequence:CCGGGATCAGGAAGGAGCATCCTAACTCGAGTTAGGATGCTCCTTCCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020662.1-871s1c1
Sequence:CCGGGATGAGGAAGAGTTGCTAGAACTCGAGTTCTAGCAACTCTTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-1167s21c1
Sequence:CCGGCTTTCGCTCTTTGGACTAATGCTCGAGCATTAGTCCAAAGAGCGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020662
VALIDATED
MRS2 MISSION shRNA shRNA Plasmid DNA
MRS2 magnesium transporter
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-311s21c1
Sequence:CCGGAGGTGAAGTGCACCGGTTTAGCTCGAGCTAAACCGGTGCACTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020662.2-2648s21c1
Sequence:CCGGTGTTACTCCCGTCGCTGATTTCTCGAGAAATCAGCGACGGGAGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1798s1c1
Sequence:CCGGCTTTGTCAGTATAGGGAATTACTCGAGTAATTCCCTATACTGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1348s1c1
Sequence:CCGGGATAGAAGCATGGAATTGAAACTCGAGTTTCAATTCCATGCTTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-522s21c1
Sequence:CCGGATCATGAGAATGGAGTATTTGCTCGAGCAAATACTCCATTCTCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-648s21c1
Sequence:GTACCGGCAACTCGTTACATACCCTTTACTCGAGTAAAGGGTATGTAACGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-342s1c1
Sequence:CCGGCCCAGTATTTACTGTGACAAACTCGAGTTTGTCACAGTAAATACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1404s1c1
Sequence:CCGGGAGCATCCTAACAAACCGTTACTCGAGTAACGGTTTGTTAGGATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-726s1c1
Sequence:CCGGCCTTGAGACCTTGGATGCTTTCTCGAGAAAGCATCCAAGGTCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020662.1-1394s1c1
Sequence:CCGGGATCAGGAAGGAGCATCCTAACTCGAGTTAGGATGCTCCTTCCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020662.1-871s1c1
Sequence:CCGGGATGAGGAAGAGTTGCTAGAACTCGAGTTCTAGCAACTCTTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-1167s21c1
Sequence:CCGGCTTTCGCTCTTTGGACTAATGCTCGAGCATTAGTCCAAAGAGCGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020662
VALIDATED
MRS2 MISSION shRNA Lentiviral Transduction Particles
MRS2 magnesium transporter
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-311s21c1
Sequence:CCGGAGGTGAAGTGCACCGGTTTAGCTCGAGCTAAACCGGTGCACTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020662.2-2648s21c1
Sequence:CCGGTGTTACTCCCGTCGCTGATTTCTCGAGAAATCAGCGACGGGAGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1798s1c1
Sequence:CCGGCTTTGTCAGTATAGGGAATTACTCGAGTAATTCCCTATACTGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1348s1c1
Sequence:CCGGGATAGAAGCATGGAATTGAAACTCGAGTTTCAATTCCATGCTTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-522s21c1
Sequence:CCGGATCATGAGAATGGAGTATTTGCTCGAGCAAATACTCCATTCTCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-648s21c1
Sequence:GTACCGGCAACTCGTTACATACCCTTTACTCGAGTAAAGGGTATGTAACGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-342s1c1
Sequence:CCGGCCCAGTATTTACTGTGACAAACTCGAGTTTGTCACAGTAAATACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-1404s1c1
Sequence:CCGGGAGCATCCTAACAAACCGTTACTCGAGTAACGGTTTGTTAGGATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020662.1-726s1c1
Sequence:CCGGCCTTGAGACCTTGGATGCTTTCTCGAGAAAGCATCCAAGGTCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020662.1-1394s1c1
Sequence:CCGGGATCAGGAAGGAGCATCCTAACTCGAGTTAGGATGCTCCTTCCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020662.1-871s1c1
Sequence:CCGGGATGAGGAAGAGTTGCTAGAACTCGAGTTCTAGCAACTCTTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020662.2-1167s21c1
Sequence:CCGGCTTTCGCTCTTTGGACTAATGCTCGAGCATTAGTCCAAAGAGCGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)