EMAIL THIS PAGE TO A FRIEND

MRTO4

mRNA turnover 4 homolog (S. cerevisiae)

45 Gene Product Result for
Synonyms: C1orf33 MRT4 dJ657E11.4
UniProtKB ID: Q9UKD2, B3KNB3, Q5TG55, Q96SS6, Q9BPV9
Gene ID:
Human(51154) Summary: This gene encodes a protein sharing a low level of sequence similarity with ribosomal protein P0. While the precise function of the encoded protein is currently unknown, it appears to be involved in mRNA turnover and ribosome assembly. [provided by RefSeq, Jul 2008]
Mouse(69902) MRT4, mRNA turnover 4, homolog (S. cerevisiae)
Rat(298586) mRNA turnover 4 homolog (S. cerevisiae)
Zebrafish(550350) mRNA turnover 4 homolog (S. cerevisiae)
cow(509932) mRNA turnover 4 homolog (S. cerevisiae)
domestic cat(101089533) mRNA turnover 4 homolog (S. cerevisiae)
dog(487406) mRNA turnover 4 homolog (S. cerevisiae)
chicken(428192) mRNA turnover 4 homolog (S. cerevisiae)
sheep(101105143) mRNA turnover 4 homolog (S. cerevisiae)
naked mole-rat(101701631) mRNA turnover 4 homolog (S. cerevisiae)
domestic guinea pig(100733886) mRNA turnover 4 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016183 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016183 Rosetta Predictions human pricing
NM_001106697 Rosetta Predictions rat pricing
NM_023536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192004 predicted 832
2 SASI_Hs02_00349001 predicted 276
3 SASI_Hs02_00349002 predicted 267
4 SASI_Hs01_00192006 predicted 425
5 SASI_Hs01_00192005 predicted 582
6 SASI_Hs01_00192008 predicted 862
7 SASI_Hs01_00192007 predicted 552
8 SASI_Hs02_00349003 predicted 487
9 SASI_Hs02_00349004 predicted 870
10 SASI_Hs02_00349005 predicted 353
11 SASI_Hs01_00192009 predicted 657
12 SASI_Hs01_00192010 predicted 541
13 SASI_Hs01_00192011 predicted 398
14 SASI_Hs01_00192012 predicted 364
15 SASI_Hs01_00192013 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221498 predicted 1074
2 SASI_Rn02_00221499 predicted 700
3 SASI_Rn02_00221500 predicted 926
4 SASI_Rn02_00221501 predicted 865
5 SASI_Rn02_00221502 predicted 1002
6 SASI_Rn02_00221503 predicted 591
7 SASI_Rn02_00221504 predicted 1024
8 SASI_Rn02_00221505 predicted 990
9 SASI_Rn02_00221506 predicted 701
10 SASI_Rn02_00221507 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099424 predicted 143
2 SASI_Mm01_00099423 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023536
VALIDATED
MRTO4 MISSION shRNA Bacterial Glycerol Stock
mRNA turnover 4 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023536.2-744s21c1
Sequence:CCGGTCCAGCGAGTTCTTCATCTTTCTCGAGAAAGATGAAGAACTCGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-77s21c1
Sequence:CCGGCCTGATAGAAGAGCTTCGGAACTCGAGTTCCGAAGCTCTTCTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-567s21c1
Sequence:CCGGATCCTGCTGTTTGGGTATGAGCTCGAGCTCATACCCAAACAGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-341s21c1
Sequence:CCGGTGAGTGGTTCACCAAGTATACCTCGAGGTATACTTGGTGAACCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-236s21c1
Sequence:CCGGTCGAAGCCCATCTGATGAATACTCGAGTATTCATCAGATGGGCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-744s1c1
Sequence:CCGGTCCAGCGAGTTCTTCATCTTTCTCGAGAAAGATGAAGAACTCGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023536.1-569s1c1
Sequence:CCGGCCTGCTGTTTGGGTATGAGATCTCGAGATCTCATACCCAAACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023536.1-558s1c1
Sequence:CCGGCAGGCCCGTATCCTGCTGTTTCTCGAGAAACAGCAGGATACGGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-352s1c1
Sequence:CCGGCCAAGTATACAGAAATGGATTCTCGAGAATCCATTTCTGTATACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-77s1c1
Sequence:CCGGCCTGATAGAAGAGCTTCGGAACTCGAGTTCCGAAGCTCTTCTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023536
VALIDATED
MRTO4 MISSION shRNA shRNA Plasmid DNA
mRNA turnover 4 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023536.2-744s21c1
Sequence:CCGGTCCAGCGAGTTCTTCATCTTTCTCGAGAAAGATGAAGAACTCGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-77s21c1
Sequence:CCGGCCTGATAGAAGAGCTTCGGAACTCGAGTTCCGAAGCTCTTCTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-567s21c1
Sequence:CCGGATCCTGCTGTTTGGGTATGAGCTCGAGCTCATACCCAAACAGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-341s21c1
Sequence:CCGGTGAGTGGTTCACCAAGTATACCTCGAGGTATACTTGGTGAACCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-236s21c1
Sequence:CCGGTCGAAGCCCATCTGATGAATACTCGAGTATTCATCAGATGGGCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-744s1c1
Sequence:CCGGTCCAGCGAGTTCTTCATCTTTCTCGAGAAAGATGAAGAACTCGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023536.1-569s1c1
Sequence:CCGGCCTGCTGTTTGGGTATGAGATCTCGAGATCTCATACCCAAACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023536.1-558s1c1
Sequence:CCGGCAGGCCCGTATCCTGCTGTTTCTCGAGAAACAGCAGGATACGGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-352s1c1
Sequence:CCGGCCAAGTATACAGAAATGGATTCTCGAGAATCCATTTCTGTATACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-77s1c1
Sequence:CCGGCCTGATAGAAGAGCTTCGGAACTCGAGTTCCGAAGCTCTTCTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023536
VALIDATED
MRTO4 MISSION shRNA Lentiviral Transduction Particles
mRNA turnover 4 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023536.2-744s21c1
Sequence:CCGGTCCAGCGAGTTCTTCATCTTTCTCGAGAAAGATGAAGAACTCGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-77s21c1
Sequence:CCGGCCTGATAGAAGAGCTTCGGAACTCGAGTTCCGAAGCTCTTCTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-567s21c1
Sequence:CCGGATCCTGCTGTTTGGGTATGAGCTCGAGCTCATACCCAAACAGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-341s21c1
Sequence:CCGGTGAGTGGTTCACCAAGTATACCTCGAGGTATACTTGGTGAACCACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023536.2-236s21c1
Sequence:CCGGTCGAAGCCCATCTGATGAATACTCGAGTATTCATCAGATGGGCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-744s1c1
Sequence:CCGGTCCAGCGAGTTCTTCATCTTTCTCGAGAAAGATGAAGAACTCGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023536.1-569s1c1
Sequence:CCGGCCTGCTGTTTGGGTATGAGATCTCGAGATCTCATACCCAAACAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023536.1-558s1c1
Sequence:CCGGCAGGCCCGTATCCTGCTGTTTCTCGAGAAACAGCAGGATACGGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-352s1c1
Sequence:CCGGCCAAGTATACAGAAATGGATTCTCGAGAATCCATTTCTGTATACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023536.1-77s1c1
Sequence:CCGGCCTGATAGAAGAGCTTCGGAACTCGAGTTCCGAAGCTCTTCTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016183
VALIDATED
MRTO4 MISSION shRNA Bacterial Glycerol Stock
mRNA turnover 4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-589s21c1
Sequence:CCGGGTGAATGAGTGGTTCACGAAACTCGAGTTTCGTGAACCACTCATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-299s21c1
Sequence:CCGGCTGCCAAGAAAGGCTTGGAATCTCGAGATTCCAAGCCTTTCTTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-489s21c1
Sequence:CCGGTCGGAGCCCATCTGATGAATACTCGAGTATTCATCAGATGGGCTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-834s21c1
Sequence:CCGGTGGGTATGAGATGGCTGAATTCTCGAGAATTCAGCCATCTCATACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-1092s21c1
Sequence:CCGGTGGGCACTGACCTCCTGTAAACTCGAGTTTACAGGAGGTCAGTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016183.2-958s1c1
Sequence:CCGGCAGATCATAAGGTCAGGAGATCTCGAGATCTCCTGACCTTATGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-75s1c1
Sequence:CCGGCTGCCAAGAAAGGCTTGGAATCTCGAGATTCCAAGCCTTTCTTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016183.2-218s1c1
Sequence:CCGGAGCCGGATGTTCTTTGGCAAACTCGAGTTTGCCAAAGAACATCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-610s1c1
Sequence:CCGGTGGGTATGAGATGGCTGAATTCTCGAGAATTCAGCCATCTCATACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-365s1c1
Sequence:CCGGGTGAATGAGTGGTTCACGAAACTCGAGTTTCGTGAACCACTCATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016183
VALIDATED
MRTO4 MISSION shRNA shRNA Plasmid DNA
mRNA turnover 4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-589s21c1
Sequence:CCGGGTGAATGAGTGGTTCACGAAACTCGAGTTTCGTGAACCACTCATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-299s21c1
Sequence:CCGGCTGCCAAGAAAGGCTTGGAATCTCGAGATTCCAAGCCTTTCTTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-489s21c1
Sequence:CCGGTCGGAGCCCATCTGATGAATACTCGAGTATTCATCAGATGGGCTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-834s21c1
Sequence:CCGGTGGGTATGAGATGGCTGAATTCTCGAGAATTCAGCCATCTCATACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-1092s21c1
Sequence:CCGGTGGGCACTGACCTCCTGTAAACTCGAGTTTACAGGAGGTCAGTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016183.2-958s1c1
Sequence:CCGGCAGATCATAAGGTCAGGAGATCTCGAGATCTCCTGACCTTATGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-75s1c1
Sequence:CCGGCTGCCAAGAAAGGCTTGGAATCTCGAGATTCCAAGCCTTTCTTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016183.2-218s1c1
Sequence:CCGGAGCCGGATGTTCTTTGGCAAACTCGAGTTTGCCAAAGAACATCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-610s1c1
Sequence:CCGGTGGGTATGAGATGGCTGAATTCTCGAGAATTCAGCCATCTCATACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-365s1c1
Sequence:CCGGGTGAATGAGTGGTTCACGAAACTCGAGTTTCGTGAACCACTCATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016183
VALIDATED
MRTO4 MISSION shRNA Lentiviral Transduction Particles
mRNA turnover 4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-589s21c1
Sequence:CCGGGTGAATGAGTGGTTCACGAAACTCGAGTTTCGTGAACCACTCATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-299s21c1
Sequence:CCGGCTGCCAAGAAAGGCTTGGAATCTCGAGATTCCAAGCCTTTCTTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-489s21c1
Sequence:CCGGTCGGAGCCCATCTGATGAATACTCGAGTATTCATCAGATGGGCTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-834s21c1
Sequence:CCGGTGGGTATGAGATGGCTGAATTCTCGAGAATTCAGCCATCTCATACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016183.3-1092s21c1
Sequence:CCGGTGGGCACTGACCTCCTGTAAACTCGAGTTTACAGGAGGTCAGTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016183.2-958s1c1
Sequence:CCGGCAGATCATAAGGTCAGGAGATCTCGAGATCTCCTGACCTTATGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-75s1c1
Sequence:CCGGCTGCCAAGAAAGGCTTGGAATCTCGAGATTCCAAGCCTTTCTTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016183.2-218s1c1
Sequence:CCGGAGCCGGATGTTCTTTGGCAAACTCGAGTTTGCCAAAGAACATCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-610s1c1
Sequence:CCGGTGGGTATGAGATGGCTGAATTCTCGAGAATTCAGCCATCTCATACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016183.2-365s1c1
Sequence:CCGGGTGAATGAGTGGTTCACGAAACTCGAGTTTCGTGAACCACTCATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)