EMAIL THIS PAGE TO A FRIEND

MS4A10

membrane-spanning 4-domains, subfamily A, member 10

44 Gene Product Result for
Synonyms: CD20L7 MS4A9
UniProtKB ID: Q96PG2, B2RP45, Q96PG3
Gene ID:
Human(341116) Summary: Most MS4A genes, including MS4A10, encode proteins with at least 4 potential transmembrane domains and N- and C-terminal cytoplasmic domains encoded by distinct exons.[supplied by OMIM, Apr 2004]
Mouse(69826) membrane-spanning 4-domains, subfamily A, member 10
Rat(293739) membrane-spanning 4-domains, subfamily A, member 10
domestic cat(101081496) membrane-spanning 4-domains, subfamily A, member 10
cow(506215) membrane-spanning 4-domains, subfamily A, member 10
domestic guinea pig(101787563) membrane-spanning 4-domains, subfamily A, member 10
sheep(101121303) membrane-spanning 4-domains, subfamily A, member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206893 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206893 Rosetta Predictions human pricing
NM_001106336 Rosetta Predictions rat pricing
NM_023529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373584 predicted 226
2 SASI_Hs02_00373585 predicted 411
3 SASI_Hs01_00200669 predicted 456
4 SASI_Hs01_00200670 predicted 351
5 SASI_Hs01_00200671 predicted 413
6 SASI_Hs01_00200672 predicted 414
7 SASI_Hs01_00200673 predicted 359
8 SASI_Hs01_00200675 predicted 449
9 SASI_Hs02_00373586 predicted 328
10 SASI_Hs01_00200676 predicted 314
11 SASI_Hs01_00200667 predicted 524
12 SASI_Hs01_00200668 predicted 231
13 SASI_Hs01_00200674 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217968 predicted 561
2 SASI_Rn02_00217969 predicted 626
3 SASI_Rn02_00217970 predicted 385
4 SASI_Rn02_00217971 predicted 580
5 SASI_Rn02_00217972 predicted 500
6 SASI_Rn02_00217973 predicted 489
7 SASI_Rn02_00217974 predicted 630
8 SASI_Rn02_00217975 predicted 388
9 SASI_Rn02_00217976 predicted 224
10 SASI_Rn02_00217977 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052702 predicted 757
2 SASI_Mm01_00052703 predicted 392
3 SASI_Mm01_00052704 predicted 432
4 SASI_Mm01_00052705 predicted 573
5 SASI_Mm01_00052706 predicted 698
6 SASI_Mm01_00052707 predicted 687
7 SASI_Mm01_00052708 predicted 551
8 SASI_Mm01_00052709 predicted 652
9 SASI_Mm01_00052710 predicted 402
10 SASI_Mm01_00052711 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206893
MS4A10 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-235s1c1
Sequence:CCGGGCACGATAAGTCCCAGAAGAACTCGAGTTCTTCTGGGACTTATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-364s1c1
Sequence:CCGGGCTGAAGTCTTGGTATCCATTCTCGAGAATGGATACCAAGACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-454s1c1
Sequence:CCGGCCTGAAGATGTTGTGCCTGATCTCGAGATCAGGCACAACATCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-794s1c1
Sequence:CCGGGACGCACAACACAAGCAACATCTCGAGATGTTGCTTGTGTTGTGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-332s1c1
Sequence:CCGGGCCTCTATAGTCAAGAACCTTCTCGAGAAGGTTCTTGACTATAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206893.3-412s21c1
Sequence:CCGGGGGATCTTGGCGATAACAATGCTCGAGCATTGTTATCGCCAAGATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206893.3-999s21c1
Sequence:CCGGAGGCTAGAGCGATGGTCTATACTCGAGTATAGACCATCGCTCTAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206893.3-1080s21c1
Sequence:CCGGCATAGTTGATGGCTCGATATCCTCGAGGATATCGAGCCATCAACTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206893.3-707s21c1
Sequence:CCGGATGCATGCCTTGTTCCGAATACTCGAGTATTCGGAACAAGGCATGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206893
MS4A10 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-235s1c1
Sequence:CCGGGCACGATAAGTCCCAGAAGAACTCGAGTTCTTCTGGGACTTATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-364s1c1
Sequence:CCGGGCTGAAGTCTTGGTATCCATTCTCGAGAATGGATACCAAGACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-454s1c1
Sequence:CCGGCCTGAAGATGTTGTGCCTGATCTCGAGATCAGGCACAACATCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-794s1c1
Sequence:CCGGGACGCACAACACAAGCAACATCTCGAGATGTTGCTTGTGTTGTGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-332s1c1
Sequence:CCGGGCCTCTATAGTCAAGAACCTTCTCGAGAAGGTTCTTGACTATAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206893.3-412s21c1
Sequence:CCGGGGGATCTTGGCGATAACAATGCTCGAGCATTGTTATCGCCAAGATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206893.3-999s21c1
Sequence:CCGGAGGCTAGAGCGATGGTCTATACTCGAGTATAGACCATCGCTCTAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206893.3-1080s21c1
Sequence:CCGGCATAGTTGATGGCTCGATATCCTCGAGGATATCGAGCCATCAACTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206893.3-707s21c1
Sequence:CCGGATGCATGCCTTGTTCCGAATACTCGAGTATTCGGAACAAGGCATGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206893
MS4A10 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-235s1c1
Sequence:CCGGGCACGATAAGTCCCAGAAGAACTCGAGTTCTTCTGGGACTTATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-364s1c1
Sequence:CCGGGCTGAAGTCTTGGTATCCATTCTCGAGAATGGATACCAAGACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-454s1c1
Sequence:CCGGCCTGAAGATGTTGTGCCTGATCTCGAGATCAGGCACAACATCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-794s1c1
Sequence:CCGGGACGCACAACACAAGCAACATCTCGAGATGTTGCTTGTGTTGTGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206893.1-332s1c1
Sequence:CCGGGCCTCTATAGTCAAGAACCTTCTCGAGAAGGTTCTTGACTATAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206893.3-412s21c1
Sequence:CCGGGGGATCTTGGCGATAACAATGCTCGAGCATTGTTATCGCCAAGATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206893.3-999s21c1
Sequence:CCGGAGGCTAGAGCGATGGTCTATACTCGAGTATAGACCATCGCTCTAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206893.3-1080s21c1
Sequence:CCGGCATAGTTGATGGCTCGATATCCTCGAGGATATCGAGCCATCAACTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206893.3-707s21c1
Sequence:CCGGATGCATGCCTTGTTCCGAATACTCGAGTATTCGGAACAAGGCATGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023529
MS4A10 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023529.1-885s1c1
Sequence:CCGGAGTAGTCTAAGACTACTAGACCTCGAGGTCTAGTAGTCTTAGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-705s1c1
Sequence:CCGGGACACACCTATGGAACTTAAACTCGAGTTTAAGTTCCATAGGTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-111s1c1
Sequence:CCGGCCCGGCAGTGTTACTGGAGAACTCGAGTTCTCCAGTAACACTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-485s1c1
Sequence:CCGGCGGCTTCTTTGTCATTGCCAACTCGAGTTGGCAATGACAAAGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-243s1c1
Sequence:CCGGCTACAGAAGTTGGGTGGCTTTCTCGAGAAAGCCACCCAACTTCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023529
MS4A10 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023529.1-885s1c1
Sequence:CCGGAGTAGTCTAAGACTACTAGACCTCGAGGTCTAGTAGTCTTAGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-705s1c1
Sequence:CCGGGACACACCTATGGAACTTAAACTCGAGTTTAAGTTCCATAGGTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-111s1c1
Sequence:CCGGCCCGGCAGTGTTACTGGAGAACTCGAGTTCTCCAGTAACACTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-485s1c1
Sequence:CCGGCGGCTTCTTTGTCATTGCCAACTCGAGTTGGCAATGACAAAGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-243s1c1
Sequence:CCGGCTACAGAAGTTGGGTGGCTTTCTCGAGAAAGCCACCCAACTTCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023529
MS4A10 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023529.1-885s1c1
Sequence:CCGGAGTAGTCTAAGACTACTAGACCTCGAGGTCTAGTAGTCTTAGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-705s1c1
Sequence:CCGGGACACACCTATGGAACTTAAACTCGAGTTTAAGTTCCATAGGTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-111s1c1
Sequence:CCGGCCCGGCAGTGTTACTGGAGAACTCGAGTTCTCCAGTAACACTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-485s1c1
Sequence:CCGGCGGCTTCTTTGTCATTGCCAACTCGAGTTGGCAATGACAAAGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023529.1-243s1c1
Sequence:CCGGCTACAGAAGTTGGGTGGCTTTCTCGAGAAAGCCACCCAACTTCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)