EMAIL THIS PAGE TO A FRIEND

MS4A12

membrane-spanning 4-domains, subfamily A, member 12

53 Gene Product Result for
Synonyms: Ms4a10
UniProtKB ID: Q9NXJ0, F5GX98, Q8N6L4
Gene ID:
Human(54860) Summary: The protein encoded by this gene is a cell surface protein found primarily in the apical membrane of colonocytes. Silencing of this gene in colon cancer cells inhibits the proliferation, cell motility, and chemotactic invasion of cells. This gene is part of a cluster of similar genes found on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(381213) membrane-spanning 4-domains, subfamily A, member 12
Rat(293741) membrane-spanning 4-domains, subfamily A, member 12
domestic guinea pig(101787488) membrane-spanning 4-domains, subfamily A, member 12
naked mole-rat(101707741) membrane-spanning 4-domains, subfamily A, member 12
domestic cat(101101668) membrane-spanning 4-domains, subfamily A, member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017716 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145361 MISSION® esiRNA esiRNA human MS4A12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017716 Rosetta Predictions human pricing
NM_001106337 Rosetta Predictions rat pricing
XM_001474614 Rosetta Predictions mouse pricing
XM_355147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210916 predicted 504
2 SASI_Hs01_00210917 predicted 735
3 SASI_Hs01_00210918 predicted 284
4 SASI_Hs01_00210919 predicted 761
5 SASI_Hs01_00210920 predicted 235
6 SASI_Hs01_00210921 predicted 207
7 SASI_Hs02_00350488 predicted 730
8 SASI_Hs01_00210923 predicted 788
9 SASI_Hs01_00210924 predicted 666
10 SASI_Hs01_00210925 predicted 537
11 SASI_Hs01_00210922 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217978 predicted 156
2 SASI_Rn02_00217979 predicted 71
3 SASI_Rn02_00217980 predicted 156
4 SASI_Rn02_00217981 predicted 82
5 SASI_Rn02_00217982 predicted 68
6 SASI_Rn02_00217983 predicted 70
7 SASI_Rn02_00217984 predicted 150
8 SASI_Rn02_00217985 predicted 143
9 SASI_Rn02_00217986 predicted 68
10 SASI_Rn02_00217987 predicted 71
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00376639 predicted 352
2 SASI_Mm02_00376640 predicted 492
3 SASI_Mm02_00376641 predicted 495
4 SASI_Mm02_00376642 predicted 464
5 SASI_Mm02_00376643 predicted 467
6 SASI_Mm02_00376644 predicted 406
7 SASI_Mm02_00376645 predicted 489
8 SASI_Mm02_00376646 predicted 430
9 SASI_Mm02_00376647 predicted 470
10 SASI_Mm02_00376648 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425800 predicted 421
2 SASI_Mm02_00425801 predicted 219
3 SASI_Mm02_00425802 predicted 219
4 SASI_Mm02_00425803 predicted 531
5 SASI_Mm02_00425804 predicted 207
6 SASI_Mm02_00425805 predicted 535
7 SASI_Mm02_00425806 predicted 478
8 SASI_Mm02_00425807 predicted 558
9 SASI_Mm02_00425808 predicted 493
10 SASI_Mm02_00425809 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017716
MS4A12 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-594s1c1
Sequence:CCGGGCTGGTGGATATGTGCATCAACTCGAGTTGATGCACATATCCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-749s1c1
Sequence:CCGGCCAATATGTCTGTCCTGGTTACTCGAGTAACCAGGACAGACATATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-829s1c1
Sequence:CCGGTGCAACAACTACTCAGCTAATCTCGAGATTAGCTGAGTAGTTGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-251s1c1
Sequence:CCGGCGGGTCAAGGAAATATACAAACTCGAGTTTGTATATTTCCTTGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-154s1c1
Sequence:CCGGCCTCTGGGTTCAATCAACTTACTCGAGTAAGTTGATTGAACCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017716
MS4A12 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-594s1c1
Sequence:CCGGGCTGGTGGATATGTGCATCAACTCGAGTTGATGCACATATCCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-749s1c1
Sequence:CCGGCCAATATGTCTGTCCTGGTTACTCGAGTAACCAGGACAGACATATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-829s1c1
Sequence:CCGGTGCAACAACTACTCAGCTAATCTCGAGATTAGCTGAGTAGTTGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-251s1c1
Sequence:CCGGCGGGTCAAGGAAATATACAAACTCGAGTTTGTATATTTCCTTGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-154s1c1
Sequence:CCGGCCTCTGGGTTCAATCAACTTACTCGAGTAAGTTGATTGAACCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017716
MS4A12 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-594s1c1
Sequence:CCGGGCTGGTGGATATGTGCATCAACTCGAGTTGATGCACATATCCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-749s1c1
Sequence:CCGGCCAATATGTCTGTCCTGGTTACTCGAGTAACCAGGACAGACATATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-829s1c1
Sequence:CCGGTGCAACAACTACTCAGCTAATCTCGAGATTAGCTGAGTAGTTGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-251s1c1
Sequence:CCGGCGGGTCAAGGAAATATACAAACTCGAGTTTGTATATTTCCTTGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017716.1-154s1c1
Sequence:CCGGCCTCTGGGTTCAATCAACTTACTCGAGTAAGTTGATTGAACCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)