EMAIL THIS PAGE TO A FRIEND

MS4A14

membrane-spanning 4-domains, subfamily A, member 14

121 Gene Product Result for
Synonyms: MS4A16 NYD-SP21
UniProtKB ID: Q96JA4, Q2TVT5, Q3B7W3, Q86XH8, Q9NTC2
Gene ID:
Mouse(383435) membrane-spanning 4-domains, subfamily A, member 14
Rat(293743) membrane-spanning 4-domains, subfamily A, member 14
domestic guinea pig(101787391) membrane-spanning 4-domains, subfamily A, member 14
sheep(101114976) membrane-spanning 4-domains, subfamily A, member 14
dog(476901) membrane-spanning 4-domains, subfamily A, member 14
cow(767816) membrane-spanning 4-domains, subfamily A, member 14
domestic cat(101101165) membrane-spanning 4-domains, subfamily A, member 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032597 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079692 Rosetta Predictions human pricing
NM_032597 Rosetta Predictions human pricing
NM_181082 Rosetta Predictions rat pricing
XM_357051 Rosetta Predictions mouse pricing
XM_908720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313700 predicted 2644
2 SASI_Hs02_00313701 predicted 2139
3 SASI_Hs02_00313702 predicted 2040
4 SASI_Hs02_00313703 predicted 2454
5 SASI_Hs02_00313704 predicted 2473
6 SASI_Hs02_00313705 predicted 2108
7 SASI_Hs02_00313706 predicted 2070
8 SASI_Hs02_00313707 predicted 1978
9 SASI_Hs02_00313708 predicted 2246
10 SASI_Hs02_00313709 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360136 predicted 2700
2 SASI_Hs01_00177887 predicted 2191
3 SASI_Hs01_00177888 predicted 2092
4 SASI_Hs01_00177890 predicted 2510
5 SASI_Hs01_00177891 predicted 2516
6 SASI_Hs01_00177892 predicted 2160
7 SASI_Hs01_00177893 predicted 2119
8 SASI_Hs01_00177894 predicted 2031
9 SASI_Hs02_00360137 predicted 2306
10 SASI_Hs01_00177895 predicted 2219
11 SASI_Hs01_00177889 predicted 436
12 SASI_Hs01_00177896 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269660 predicted 2098
2 SASI_Rn02_00269661 predicted 1267
3 SASI_Rn01_00058767 predicted 3533
4 SASI_Rn01_00058768 predicted 1558
5 SASI_Rn01_00058769 predicted 3381
6 SASI_Rn01_00058770 predicted 2064
7 SASI_Rn01_00058771 predicted 1830
8 SASI_Rn01_00058773 predicted 2395
9 SASI_Rn02_00269662 predicted 964
10 SASI_Rn01_00058765 predicted 2114
11 SASI_Rn01_00058766 predicted 2195
12 SASI_Rn01_00058772 predicted 2637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204326 predicted 3610
2 SASI_Mm01_00204327 predicted 986
3 SASI_Mm01_00204328 predicted 1271
4 SASI_Mm01_00204329 predicted 452
5 SASI_Mm01_00204330 predicted 499
6 SASI_Mm01_00204331 predicted 1070
7 SASI_Mm02_00426018 predicted 910
8 SASI_Mm01_00204332 predicted 2083
9 SASI_Mm01_00204333 predicted 672
10 SASI_Mm01_00204334 predicted 2030
11 SASI_Mm01_00204335 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434325 predicted 3286
2 SASI_Mm02_00434326 predicted 3609
3 SASI_Mm02_00434327 predicted 982
4 SASI_Mm02_00434328 predicted 1274
5 SASI_Mm02_00434329 predicted 453
6 SASI_Mm02_00434330 predicted 493
7 SASI_Mm02_00434331 predicted 1068
8 SASI_Mm02_00434332 predicted 913
9 SASI_Mm02_00434333 predicted 3171
10 SASI_Mm02_00434334 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032597
MS4A14 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-1998s1c1
Sequence:CCGGGCCAAGATTCAGAATCCCAAACTCGAGTTTGGGATTCTGAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-133s1c1
Sequence:CCGGCGAAACTGTATTGACTGCATTCTCGAGAATGCAGTCAATACAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-1358s1c1
Sequence:CCGGCCTGAAATACAACACCTACTTCTCGAGAAGTAGGTGTTGTATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-233s1c1
Sequence:CCGGGCTCTAATCATTGTGGGCTTTCTCGAGAAAGCCCACAATGATTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-737s1c1
Sequence:CCGGCCAGGTAATAAAGGTAGAGAACTCGAGTTCTCTACCTTTATTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032597.3-2210s21c1
Sequence:CCGGGATAAGCAAGCTCAACTTAATCTCGAGATTAAGTTGAGCTTGCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032597.3-2306s21c1
Sequence:CCGGTCTAAAGATGGACAAGTTAAACTCGAGTTTAACTTGTCCATCTTTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032597
MS4A14 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-1998s1c1
Sequence:CCGGGCCAAGATTCAGAATCCCAAACTCGAGTTTGGGATTCTGAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-133s1c1
Sequence:CCGGCGAAACTGTATTGACTGCATTCTCGAGAATGCAGTCAATACAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-1358s1c1
Sequence:CCGGCCTGAAATACAACACCTACTTCTCGAGAAGTAGGTGTTGTATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-233s1c1
Sequence:CCGGGCTCTAATCATTGTGGGCTTTCTCGAGAAAGCCCACAATGATTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-737s1c1
Sequence:CCGGCCAGGTAATAAAGGTAGAGAACTCGAGTTCTCTACCTTTATTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032597.3-2210s21c1
Sequence:CCGGGATAAGCAAGCTCAACTTAATCTCGAGATTAAGTTGAGCTTGCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032597.3-2306s21c1
Sequence:CCGGTCTAAAGATGGACAAGTTAAACTCGAGTTTAACTTGTCCATCTTTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032597
MS4A14 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-1998s1c1
Sequence:CCGGGCCAAGATTCAGAATCCCAAACTCGAGTTTGGGATTCTGAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-133s1c1
Sequence:CCGGCGAAACTGTATTGACTGCATTCTCGAGAATGCAGTCAATACAGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-1358s1c1
Sequence:CCGGCCTGAAATACAACACCTACTTCTCGAGAAGTAGGTGTTGTATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-233s1c1
Sequence:CCGGGCTCTAATCATTGTGGGCTTTCTCGAGAAAGCCCACAATGATTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032597.2-737s1c1
Sequence:CCGGCCAGGTAATAAAGGTAGAGAACTCGAGTTCTCTACCTTTATTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032597.3-2210s21c1
Sequence:CCGGGATAAGCAAGCTCAACTTAATCTCGAGATTAAGTTGAGCTTGCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032597.3-2306s21c1
Sequence:CCGGTCTAAAGATGGACAAGTTAAACTCGAGTTTAACTTGTCCATCTTTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)