EMAIL THIS PAGE TO A FRIEND

MS4A2

membrane-spanning 4-domains, subfamily A, member 2

228 Gene Product Result for
Synonyms: APY ATOPY FCER1B FCERI IGEL IGER IGHER MS4A1
UniProtKB ID: Q01362, Q54A81
Gene ID:
Human(2206) Summary: The allergic response involves the binding of allergen to receptor-bound IgE followed by cell activation and the release of mediators responsible for the manifestations of allergy. The IgE-receptor, a tetramer composed of an alpha, beta, and 2 disulfide-linked gamma chains, is found on the surface of mast cells and basophils. This gene encodes the beta subunit of the high affinity IgE receptor which is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member is localized to 11q12, among a cluster of membrane-spanning 4A gene family members. Alternative splicing results in multiple transcript variants encoding distinct proteins. Additional transcript variants have been described but require experimental validation. [provided by RefSeq, Mar 2012]
Mouse(14126) membrane-spanning 4-domains, subfamily A, member 2
Rat(25316) membrane-spanning 4-domains, subfamily A, member 2
sheep(443203) membrane-spanning 4-domains, subfamily A, member 2
domestic guinea pig(100715296) membrane-spanning 4-domains, subfamily A, member 2
naked mole-rat(101703025) membrane-spanning 4-domains, subfamily A, member 2
dog(403799) membrane-spanning 4-domains, subfamily A, member 2
domestic cat(101101505) membrane-spanning 4-domains, subfamily A, member 2
Horse(100033954) membrane-spanning 4-domains, subfamily A, member 2
cow(531987) membrane-spanning 4-domains, subfamily A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038461 MISSION® esiRNA esiRNA human MS4A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000139 Rosetta Predictions human pricing
NM_012845 Rosetta Predictions rat pricing
NM_013516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050065 predicted 431
2 SASI_Hs01_00050066 predicted 302
3 SASI_Hs01_00050067 predicted 853
4 SASI_Hs01_00050068 predicted 773
5 SASI_Hs01_00050069 predicted 424
6 SASI_Hs01_00050070 predicted 565
7 SASI_Hs01_00050072 predicted 210
8 SASI_Hs01_00050073 predicted 607
9 SASI_Hs02_00301948 predicted 291
10 SASI_Hs02_00301949 predicted 631
11 SASI_Hs01_00050064 predicted 538
12 SASI_Hs01_00050071 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111549 predicted 511
2 SASI_Rn01_00111550 predicted 307
3 SASI_Rn01_00111551 predicted 839
4 SASI_Rn01_00111552 predicted 711
5 SASI_Rn01_00111554 predicted 813
6 SASI_Rn01_00111555 predicted 416
7 SASI_Rn01_00111556 predicted 727
8 SASI_Rn01_00111557 predicted 698
9 SASI_Rn02_00260314 predicted 792
10 SASI_Rn01_00111558 predicted 640
11 SASI_Rn01_00111553 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136036 predicted 459
2 SASI_Mm01_00136037 predicted 584
3 SASI_Mm01_00136038 predicted 357
4 SASI_Mm01_00136039 predicted 233
5 SASI_Mm01_00136040 predicted 577
6 SASI_Mm01_00136041 predicted 393
7 SASI_Mm01_00136043 predicted 597
8 SASI_Mm01_00136044 predicted 575
9 SASI_Mm01_00136045 predicted 747
10 SASI_Mm02_00322189 predicted 668
11 SASI_Mm01_00136042 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000139
MS4A2 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000139.3-1117s21c1
Sequence:CCGGTGATTATAACTGTGCAAATACCTCGAGGTATTTGCACAGTTATAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000139.3-1024s21c1
Sequence:CCGGAGATATGATAGACTCCTATTTCTCGAGAAATAGGAGTCTATCATATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000139.3-199s21c1
Sequence:CCGGGTATCTTCAGGCAGACTATTGCTCGAGCAATAGTCTGCCTGAAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000139.2-1151s1c1
Sequence:CCGGGCTGGCTGAAAGTTGAGTTAACTCGAGTTAACTCAACTTTCAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-337s1c1
Sequence:CCGGGTCTGCTCTGTACTTGATATTCTCGAGAATATCAAGTACAGAGCAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-151s1c1
Sequence:CCGGCCTTCCAGTGTGCCTGCATTTCTCGAGAAATGCAGGCACACTGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-457s1c1
Sequence:CCGGGAAAGGAGAAATGCAACATATCTCGAGATATGTTGCATTTCTCCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-742s1c1
Sequence:CCGGCCAGAGGATCGTGTTTATGAACTCGAGTTCATAAACACGATCCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000139
MS4A2 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000139.3-1117s21c1
Sequence:CCGGTGATTATAACTGTGCAAATACCTCGAGGTATTTGCACAGTTATAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000139.3-1024s21c1
Sequence:CCGGAGATATGATAGACTCCTATTTCTCGAGAAATAGGAGTCTATCATATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000139.3-199s21c1
Sequence:CCGGGTATCTTCAGGCAGACTATTGCTCGAGCAATAGTCTGCCTGAAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000139.2-1151s1c1
Sequence:CCGGGCTGGCTGAAAGTTGAGTTAACTCGAGTTAACTCAACTTTCAGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-337s1c1
Sequence:CCGGGTCTGCTCTGTACTTGATATTCTCGAGAATATCAAGTACAGAGCAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-151s1c1
Sequence:CCGGCCTTCCAGTGTGCCTGCATTTCTCGAGAAATGCAGGCACACTGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-457s1c1
Sequence:CCGGGAAAGGAGAAATGCAACATATCTCGAGATATGTTGCATTTCTCCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-742s1c1
Sequence:CCGGCCAGAGGATCGTGTTTATGAACTCGAGTTCATAAACACGATCCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000139
MS4A2 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000139.3-1117s21c1
Sequence:CCGGTGATTATAACTGTGCAAATACCTCGAGGTATTTGCACAGTTATAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000139.3-1024s21c1
Sequence:CCGGAGATATGATAGACTCCTATTTCTCGAGAAATAGGAGTCTATCATATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000139.3-199s21c1
Sequence:CCGGGTATCTTCAGGCAGACTATTGCTCGAGCAATAGTCTGCCTGAAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000139.2-1151s1c1
Sequence:CCGGGCTGGCTGAAAGTTGAGTTAACTCGAGTTAACTCAACTTTCAGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-337s1c1
Sequence:CCGGGTCTGCTCTGTACTTGATATTCTCGAGAATATCAAGTACAGAGCAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-151s1c1
Sequence:CCGGCCTTCCAGTGTGCCTGCATTTCTCGAGAAATGCAGGCACACTGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-457s1c1
Sequence:CCGGGAAAGGAGAAATGCAACATATCTCGAGATATGTTGCATTTCTCCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000139.2-742s1c1
Sequence:CCGGCCAGAGGATCGTGTTTATGAACTCGAGTTCATAAACACGATCCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013516
MS4A2 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013516.1-743s1c1
Sequence:CCGGCAGGACAATCTGATTCAAGTACTCGAGTACTTGAATCAGATTGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-452s1c1
Sequence:CCGGCTGACCAATAACTTCGCTTATCTCGAGATAAGCGAAGTTATTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-466s1c1
Sequence:CCGGCGCTTATATGAACAACTGCAACTCGAGTTGCAGTTGTTCATATAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-581s1c1
Sequence:CCGGGCTGTGTTGTTCACTATCTATCTCGAGATAGATAGTGAACAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-635s1c1
Sequence:CCGGCCAGATGATCGTCTTTATGAACTCGAGTTCATAAAGACGATCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013516
MS4A2 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013516.1-743s1c1
Sequence:CCGGCAGGACAATCTGATTCAAGTACTCGAGTACTTGAATCAGATTGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-452s1c1
Sequence:CCGGCTGACCAATAACTTCGCTTATCTCGAGATAAGCGAAGTTATTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-466s1c1
Sequence:CCGGCGCTTATATGAACAACTGCAACTCGAGTTGCAGTTGTTCATATAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-581s1c1
Sequence:CCGGGCTGTGTTGTTCACTATCTATCTCGAGATAGATAGTGAACAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-635s1c1
Sequence:CCGGCCAGATGATCGTCTTTATGAACTCGAGTTCATAAAGACGATCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013516
MS4A2 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013516.1-743s1c1
Sequence:CCGGCAGGACAATCTGATTCAAGTACTCGAGTACTTGAATCAGATTGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-452s1c1
Sequence:CCGGCTGACCAATAACTTCGCTTATCTCGAGATAAGCGAAGTTATTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-466s1c1
Sequence:CCGGCGCTTATATGAACAACTGCAACTCGAGTTGCAGTTGTTCATATAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-581s1c1
Sequence:CCGGGCTGTGTTGTTCACTATCTATCTCGAGATAGATAGTGAACAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013516.1-635s1c1
Sequence:CCGGCCAGATGATCGTCTTTATGAACTCGAGTTCATAAAGACGATCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)