EMAIL THIS PAGE TO A FRIEND

MS4A3

membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)

108 Gene Product Result for
Synonyms: CD20L HTM4
UniProtKB ID: Q96HJ5, A8MTP8, Q8NHW2
Gene ID:
Human(932) Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member likely plays a role in signal transduction and may function as a subunit associated with receptor complexes. The gene encoding this protein is localized to 11q12, among a cluster of related family members. Alternative splicing may result in multiple transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Mouse(170813) membrane-spanning 4-domains, subfamily A, member 3
Rat(293753) membrane-spanning 4-domains, subfamily A, member 3
domestic cat(101100154) membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
cow(100847592) membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
sheep(101114726) membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006138 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065831 MISSION® esiRNA esiRNA human MS4A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031666 Rosetta Predictions human pricing
NM_001031809 Rosetta Predictions human pricing
NM_006138 Rosetta Predictions human pricing
XM_001075551 Rosetta Predictions rat pricing
XM_219599 Rosetta Predictions rat pricing
NM_133246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134190 predicted 561
2 SASI_Hs01_00134191 predicted 661
3 SASI_Hs01_00134193 predicted 409
4 SASI_Hs01_00134195 predicted 672
5 SASI_Hs01_00134196 predicted 547
6 SASI_Hs01_00134197 predicted 442
7 SASI_Hs01_00134198 predicted 502
8 SASI_Hs02_00307664 predicted 571
9 SASI_Hs02_00307665 predicted 701
10 SASI_Hs02_00307666 predicted 532
11 SASI_Hs01_00134192 predicted 639
12 SASI_Hs01_00134194 predicted 627
13 SASI_Hs01_00134199 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013694 predicted 730
2 SASI_Hs01_00013695 predicted 837
3 SASI_Hs01_00013697 predicted 576
4 SASI_Hs01_00013699 predicted 849
5 SASI_Hs01_00013700 predicted 715
6 SASI_Hs01_00013701 predicted 619
7 SASI_Hs01_00013702 predicted 668
8 SASI_Hs02_00307821 predicted 746
9 SASI_Hs02_00307822 predicted 869
10 SASI_Hs02_00307823 predicted 699
11 SASI_Hs01_00013696 predicted 805
12 SASI_Hs01_00013698 predicted 791
13 SASI_Hs01_00013703 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113995 predicted 870
2 SASI_Hs01_00113996 predicted 976
3 SASI_Hs01_00113998 predicted 714
4 SASI_Hs01_00114000 predicted 984
5 SASI_Hs01_00114001 predicted 854
6 SASI_Hs01_00114002 predicted 749
7 SASI_Hs01_00114003 predicted 805
8 SASI_Hs02_00340970 predicted 882
9 SASI_Hs02_00340971 predicted 1006
10 SASI_Hs02_00340972 predicted 843
11 SASI_Hs01_00113997 predicted 942
12 SASI_Hs01_00113999 predicted 927
13 SASI_Hs01_00114004 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350195 predicted 317
2 SASI_Rn02_00350196 predicted 446
3 SASI_Rn02_00350197 predicted 286
4 SASI_Rn02_00350198 predicted 434
5 SASI_Rn02_00350199 predicted 365
6 SASI_Rn02_00350200 predicted 397
7 SASI_Rn02_00350201 predicted 414
8 SASI_Rn02_00350202 predicted 448
9 SASI_Rn02_00350203 predicted 391
10 SASI_Rn02_00350204 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378575 predicted 317
2 SASI_Rn02_00378576 predicted 452
3 SASI_Rn02_00378577 predicted 287
4 SASI_Rn02_00378578 predicted 427
5 SASI_Rn02_00378579 predicted 368
6 SASI_Rn02_00378580 predicted 399
7 SASI_Rn02_00378581 predicted 415
8 SASI_Rn02_00378582 predicted 450
9 SASI_Rn02_00378583 predicted 397
10 SASI_Rn02_00378584 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064646 predicted 497
2 SASI_Mm01_00064647 predicted 554
3 SASI_Mm01_00064648 predicted 721
4 SASI_Mm01_00064649 predicted 739
5 SASI_Mm01_00064650 predicted 547
6 SASI_Mm01_00064652 predicted 719
7 SASI_Mm01_00064653 predicted 516
8 SASI_Mm01_00064654 predicted 782
9 SASI_Mm01_00064655 predicted 764
10 SASI_Mm02_00338499 predicted 506
11 SASI_Mm01_00064651 predicted 716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133246
MS4A3 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-752s1c1
Sequence:CCGGAGGCAATTACTTCACCTCCTACTCGAGTAGGAGGTGAAGTAATTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-740s1c1
Sequence:CCGGGTGGTTTAAGAGAGGCAATTACTCGAGTAATTGCCTCTCTTAAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-321s1c1
Sequence:CCGGACTGATTCTAGCTCTCGGAATCTCGAGATTCCGAGAGCTAGAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-520s1c1
Sequence:CCGGGCCAGTACTACAATTGCATTTCTCGAGAAATGCAATTGTAGTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133246
MS4A3 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-752s1c1
Sequence:CCGGAGGCAATTACTTCACCTCCTACTCGAGTAGGAGGTGAAGTAATTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-740s1c1
Sequence:CCGGGTGGTTTAAGAGAGGCAATTACTCGAGTAATTGCCTCTCTTAAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-321s1c1
Sequence:CCGGACTGATTCTAGCTCTCGGAATCTCGAGATTCCGAGAGCTAGAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-520s1c1
Sequence:CCGGGCCAGTACTACAATTGCATTTCTCGAGAAATGCAATTGTAGTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133246
MS4A3 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-752s1c1
Sequence:CCGGAGGCAATTACTTCACCTCCTACTCGAGTAGGAGGTGAAGTAATTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-740s1c1
Sequence:CCGGGTGGTTTAAGAGAGGCAATTACTCGAGTAATTGCCTCTCTTAAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-321s1c1
Sequence:CCGGACTGATTCTAGCTCTCGGAATCTCGAGATTCCGAGAGCTAGAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133246.2-520s1c1
Sequence:CCGGGCCAGTACTACAATTGCATTTCTCGAGAAATGCAATTGTAGTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006138
MS4A3 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-205s1c1
Sequence:CCGGCCATAAATGGATCACCAGATTCTCGAGAATCTGGTGATCCATTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-644s1c1
Sequence:CCGGGCTGGAATTATGCGTAACTATCTCGAGATAGTTACGCATAATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-437s1c1
Sequence:CCGGCACAAGAACATGGATACAGAACTCGAGTTCTGTATCCATGTTCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-697s1c1
Sequence:CCGGGCTGTAATTCAAGAGAGGAAACTCGAGTTTCCTCTCTTGAATTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-528s1c1
Sequence:CCGGGCAGTTAATATCCAGTCATTACTCGAGTAATGACTGGATATTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006138
MS4A3 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-205s1c1
Sequence:CCGGCCATAAATGGATCACCAGATTCTCGAGAATCTGGTGATCCATTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-644s1c1
Sequence:CCGGGCTGGAATTATGCGTAACTATCTCGAGATAGTTACGCATAATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-437s1c1
Sequence:CCGGCACAAGAACATGGATACAGAACTCGAGTTCTGTATCCATGTTCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-697s1c1
Sequence:CCGGGCTGTAATTCAAGAGAGGAAACTCGAGTTTCCTCTCTTGAATTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-528s1c1
Sequence:CCGGGCAGTTAATATCCAGTCATTACTCGAGTAATGACTGGATATTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006138
MS4A3 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-205s1c1
Sequence:CCGGCCATAAATGGATCACCAGATTCTCGAGAATCTGGTGATCCATTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-644s1c1
Sequence:CCGGGCTGGAATTATGCGTAACTATCTCGAGATAGTTACGCATAATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-437s1c1
Sequence:CCGGCACAAGAACATGGATACAGAACTCGAGTTCTGTATCCATGTTCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-697s1c1
Sequence:CCGGGCTGTAATTCAAGAGAGGAAACTCGAGTTTCCTCTCTTGAATTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006138.3-528s1c1
Sequence:CCGGGCAGTTAATATCCAGTCATTACTCGAGTAATGACTGGATATTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)