EMAIL THIS PAGE TO A FRIEND

MS4A4A

membrane-spanning 4-domains, subfamily A, member 4A

109 Gene Product Result for
Synonyms: 4SPAN1 CD20-L1 CD20L1 MS4A4 MS4A7
UniProtKB ID: Q96JQ5, Q8TEZ6, Q96PG7, Q9BY18, Q9H3V3, Q9P1S3
Gene ID:
Human(51338) Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features, similar intron/exon splice boundaries, and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(666907) membrane-spanning 4-domains, subfamily A, member 4A
Rat(361734) membrane-spanning 4-domains, subfamily A, member 4A
dog(476900) membrane-spanning 4-domains, subfamily A, member 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024021 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132841 MISSION® esiRNA esiRNA human MS4A4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024021 Rosetta Predictions human pricing
NM_148975 Rosetta Predictions human pricing
XM_001075321 Rosetta Predictions rat pricing
XM_342027 Rosetta Predictions rat pricing
XM_986941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150955 predicted 880
2 SASI_Hs01_00150956 predicted 375
3 SASI_Hs01_00150957 predicted 889
4 SASI_Hs02_00356447 predicted 790
5 SASI_Hs01_00150958 predicted 347
6 SASI_Hs01_00150959 predicted 531
7 SASI_Hs01_00150960 predicted 861
8 SASI_Hs01_00150961 predicted 895
9 SASI_Hs01_00150964 predicted 824
10 SASI_Hs02_00356448 predicted 363
11 SASI_Hs01_00150962 predicted 338
12 SASI_Hs01_00150963 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149624 predicted 807
2 SASI_Hs01_00149625 predicted 299
3 SASI_Hs01_00149626 predicted 817
4 SASI_Hs02_00365689 predicted 720
5 SASI_Hs01_00149627 predicted 268
6 SASI_Hs01_00149628 predicted 460
7 SASI_Hs01_00149629 predicted 783
8 SASI_Hs01_00149630 predicted 824
9 SASI_Hs01_00149633 predicted 747
10 SASI_Hs02_00365690 predicted 280
11 SASI_Hs01_00149631 predicted 268
12 SASI_Hs01_00149632 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349330 predicted 545
2 SASI_Rn02_00349331 predicted 450
3 SASI_Rn02_00349332 predicted 573
4 SASI_Rn02_00349333 predicted 225
5 SASI_Rn02_00349334 predicted 282
6 SASI_Rn02_00349335 predicted 519
7 SASI_Rn02_00349336 predicted 651
8 SASI_Rn02_00349337 predicted 388
9 SASI_Rn02_00349338 predicted 459
10 SASI_Rn02_00349339 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393664 predicted 680
2 SASI_Rn02_00393665 predicted 668
3 SASI_Rn02_00393666 predicted 545
4 SASI_Rn02_00393667 predicted 111
5 SASI_Rn02_00393668 predicted 579
6 SASI_Rn02_00393669 predicted 232
7 SASI_Rn02_00393670 predicted 276
8 SASI_Rn02_00393671 predicted 440
9 SASI_Rn02_00393672 predicted 463
10 SASI_Rn02_00393673 predicted 85
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272517 predicted 521
2 SASI_Mm01_00272518 predicted 261
3 SASI_Mm02_00449183 predicted 291
4 SASI_Mm02_00449184 predicted 609
5 SASI_Mm01_00272519 predicted 324
6 SASI_Mm01_00272521 predicted 462
7 SASI_Mm01_00272522 predicted 511
8 SASI_Mm01_00272523 predicted 543
9 SASI_Mm02_00449185 predicted 323
10 SASI_Mm01_00272524 predicted 380
11 SASI_Mm01_00272520 predicted 616
12 SASI_Mm01_00272525 predicted 645
13 SASI_Mm01_00272526 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024021
MS4A4A MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 4A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024021.2-1209s21c1
Sequence:CCGGCATACTTCCCTCCCATTTATTCTCGAGAATAAATGGGAGGGAAGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024021.2-515s21c1
Sequence:CCGGGGCTGCATCAGGGATCTTAATCTCGAGATTAAGATCCCTGATGCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-379s1c1
Sequence:CCGGCCGTGTATATCGGGTACACAACTCGAGTTGTGTACCCGATATACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-477s1c1
Sequence:CCGGCGAGGTAGTCTAGGAATGAATCTCGAGATTCATTCCTAGACTACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-252s1c1
Sequence:CCGGGAGAAGTTCTTGAAGGGAGAACTCGAGTTCTCCCTTCAAGAACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-609s1c1
Sequence:CCGGCATGGGACTATGTCCATCTTACTCGAGTAAGATGGACATAGTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-783s1c1
Sequence:CCGGCCCACACCACTTAATGAGGTTCTCGAGAACCTCATTAAGTGGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024021
MS4A4A MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 4A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024021.2-1209s21c1
Sequence:CCGGCATACTTCCCTCCCATTTATTCTCGAGAATAAATGGGAGGGAAGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024021.2-515s21c1
Sequence:CCGGGGCTGCATCAGGGATCTTAATCTCGAGATTAAGATCCCTGATGCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-379s1c1
Sequence:CCGGCCGTGTATATCGGGTACACAACTCGAGTTGTGTACCCGATATACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-477s1c1
Sequence:CCGGCGAGGTAGTCTAGGAATGAATCTCGAGATTCATTCCTAGACTACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-252s1c1
Sequence:CCGGGAGAAGTTCTTGAAGGGAGAACTCGAGTTCTCCCTTCAAGAACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-609s1c1
Sequence:CCGGCATGGGACTATGTCCATCTTACTCGAGTAAGATGGACATAGTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-783s1c1
Sequence:CCGGCCCACACCACTTAATGAGGTTCTCGAGAACCTCATTAAGTGGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024021
MS4A4A MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 4A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024021.2-1209s21c1
Sequence:CCGGCATACTTCCCTCCCATTTATTCTCGAGAATAAATGGGAGGGAAGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024021.2-515s21c1
Sequence:CCGGGGCTGCATCAGGGATCTTAATCTCGAGATTAAGATCCCTGATGCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-379s1c1
Sequence:CCGGCCGTGTATATCGGGTACACAACTCGAGTTGTGTACCCGATATACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-477s1c1
Sequence:CCGGCGAGGTAGTCTAGGAATGAATCTCGAGATTCATTCCTAGACTACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-252s1c1
Sequence:CCGGGAGAAGTTCTTGAAGGGAGAACTCGAGTTCTCCCTTCAAGAACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-609s1c1
Sequence:CCGGCATGGGACTATGTCCATCTTACTCGAGTAAGATGGACATAGTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024021.2-783s1c1
Sequence:CCGGCCCACACCACTTAATGAGGTTCTCGAGAACCTCATTAAGTGGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)