EMAIL THIS PAGE TO A FRIEND

MS4A5

membrane-spanning 4-domains, subfamily A, member 5

55 Gene Product Result for
Synonyms: CD20-L2 CD20L2 TETM4
UniProtKB ID: Q9H3V2, Q9BZH1
Gene ID:
Human(64232) Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. Though this member is not expressed in hematopoietic cells specifically, it may be involved in signal transduction like many of its related family members. The gene encoding this protein is localized to 11q12, among a cluster of family members. [provided by RefSeq, Jul 2008]
Mouse(269063) membrane-spanning 4-domains, subfamily A, member 5
Rat(686680) membrane-spanning 4-domains, subfamily A, member 5
dog(612568) membrane-spanning 4-domains, subfamily A, member 5
cow(777599) membrane-spanning 4-domains, subfamily A, member 5
domestic cat(101101413) membrane-spanning 4-domains, subfamily A, member 5
sheep(101113009) membrane-spanning 4-domains, subfamily A, member 5
domestic guinea pig(100719761) membrane-spanning 4-domains, subfamily A, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023945 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014381 MISSION® esiRNA esiRNA targeting human MS4A5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023945 Rosetta Predictions human pricing
XM_001075247 Rosetta Predictions rat pricing
NM_183190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037769 predicted 407
2 SASI_Hs01_00037770 predicted 488
3 SASI_Hs01_00037771 predicted 481
4 SASI_Hs01_00037772 predicted 475
5 SASI_Hs01_00037773 predicted 416
6 SASI_Hs01_00037774 predicted 460
7 SASI_Hs01_00037775 predicted 489
8 SASI_Hs01_00037777 predicted 457
9 SASI_Hs01_00037778 predicted 473
10 SASI_Hs02_00356417 predicted 428
11 SASI_Hs01_00037776 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348962 predicted 383
2 SASI_Rn02_00348963 predicted 459
3 SASI_Rn02_00348964 predicted 507
4 SASI_Rn02_00348965 predicted 216
5 SASI_Rn02_00348966 predicted 519
6 SASI_Rn02_00348967 predicted 531
7 SASI_Rn02_00348968 predicted 279
8 SASI_Rn02_00348969 predicted 655
9 SASI_Rn02_00348970 predicted 243
10 SASI_Rn02_00348971 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350301 predicted 237
2 SASI_Mm02_00350302 predicted 484
3 SASI_Mm01_00166231 predicted 404
4 SASI_Mm02_00350303 predicted 482
5 SASI_Mm01_00166232 predicted 424
6 SASI_Mm02_00350304 predicted 482
7 SASI_Mm02_00350305 predicted 607
8 SASI_Mm02_00350306 predicted 496
9 SASI_Mm02_00350307 predicted 454
10 SASI_Mm02_00350308 predicted 467
11 SASI_Mm01_00166233 predicted 466
12 SASI_Mm01_00166234 predicted 236
13 SASI_Mm01_00166235 predicted 236
14 SASI_Mm01_00166236 predicted 464
15 SASI_Mm01_00166237 predicted 422
16 SASI_Mm01_00166238 predicted 487
17 SASI_Mm01_00166239 predicted 435
18 SASI_Mm01_00166240 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183190
MS4A5 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-432s1c1
Sequence:CCGGCGGGCAATGAATTTACTTAGTCTCGAGACTAAGTAAATTCATTGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-599s1c1
Sequence:CCGGCAGCATTGTTGAACTCTTCATCTCGAGATGAAGAGTTCAACAATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-468s1c1
Sequence:CCGGGCTGGAATCATTCTCCTCATACTCGAGTATGAGGAGAATGATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183190.2-760s1c1
Sequence:CCGGGCTGGTTAAACACATTCTTCTCTCGAGAGAAGAATGTGTTTAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-130s21c1
Sequence:CCGGACCGAGTGCAGAAGATCATTACTCGAGTAATGATCTTCTGCACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183190.2-694s21c1
Sequence:CCGGCACACTTAAAGTTCACAATTACTCGAGTAATTGTGAACTTTAAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-102s21c1
Sequence:CCGGCTTACAGCCACAGCCTATAATCTCGAGATTATAGGCTGTGGCTGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-478s21c1
Sequence:CCGGGTATGCAGTGTGGTGTTATTACTCGAGTAATAACACCACACTGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-613s21c1
Sequence:CCGGGAATAGTACTGTACAAGTAAACTCGAGTTTACTTGTACAGTACTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183190
MS4A5 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-432s1c1
Sequence:CCGGCGGGCAATGAATTTACTTAGTCTCGAGACTAAGTAAATTCATTGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-599s1c1
Sequence:CCGGCAGCATTGTTGAACTCTTCATCTCGAGATGAAGAGTTCAACAATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-468s1c1
Sequence:CCGGGCTGGAATCATTCTCCTCATACTCGAGTATGAGGAGAATGATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183190.2-760s1c1
Sequence:CCGGGCTGGTTAAACACATTCTTCTCTCGAGAGAAGAATGTGTTTAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-130s21c1
Sequence:CCGGACCGAGTGCAGAAGATCATTACTCGAGTAATGATCTTCTGCACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183190.2-694s21c1
Sequence:CCGGCACACTTAAAGTTCACAATTACTCGAGTAATTGTGAACTTTAAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-102s21c1
Sequence:CCGGCTTACAGCCACAGCCTATAATCTCGAGATTATAGGCTGTGGCTGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-478s21c1
Sequence:CCGGGTATGCAGTGTGGTGTTATTACTCGAGTAATAACACCACACTGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-613s21c1
Sequence:CCGGGAATAGTACTGTACAAGTAAACTCGAGTTTACTTGTACAGTACTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183190
MS4A5 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-432s1c1
Sequence:CCGGCGGGCAATGAATTTACTTAGTCTCGAGACTAAGTAAATTCATTGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-599s1c1
Sequence:CCGGCAGCATTGTTGAACTCTTCATCTCGAGATGAAGAGTTCAACAATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183190.1-468s1c1
Sequence:CCGGGCTGGAATCATTCTCCTCATACTCGAGTATGAGGAGAATGATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183190.2-760s1c1
Sequence:CCGGGCTGGTTAAACACATTCTTCTCTCGAGAGAAGAATGTGTTTAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-130s21c1
Sequence:CCGGACCGAGTGCAGAAGATCATTACTCGAGTAATGATCTTCTGCACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183190.2-694s21c1
Sequence:CCGGCACACTTAAAGTTCACAATTACTCGAGTAATTGTGAACTTTAAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-102s21c1
Sequence:CCGGCTTACAGCCACAGCCTATAATCTCGAGATTATAGGCTGTGGCTGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-478s21c1
Sequence:CCGGGTATGCAGTGTGGTGTTATTACTCGAGTAATAACACCACACTGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183190.2-613s21c1
Sequence:CCGGGAATAGTACTGTACAAGTAAACTCGAGTTTACTTGTACAGTACTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023945
MS4A5 MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-384s1c1
Sequence:CCGGGCCTTCCTAATTGCAGTGAAACTCGAGTTTCACTGCAATTAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-423s1c1
Sequence:CCGGCTGATAATATTGAGCCGAATACTCGAGTATTCGGCTCAATATTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-252s1c1
Sequence:CCGGCTGTTTGGAATTATGACCTTTCTCGAGAAAGGTCATAATTCCAAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-475s1c1
Sequence:CCGGCTGGAATCATTCTCCTCACATCTCGAGATGTGAGGAGAATGATTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-565s1c1
Sequence:CCGGCTGTCCTGTTCTTGGGAATTTCTCGAGAAATTCCCAAGAACAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-453s21c1
Sequence:CCGGCTTAGTGCCCTGGGAGCAATACTCGAGTATTGCTCCCAGGGCACTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-592s21c1
Sequence:CCGGCATTGATGACTTTCAGCATTACTCGAGTAATGCTGAAAGTCATCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-517s21c1
Sequence:CCGGACTACATTTGTGGTTATTCTCCTCGAGGAGAATAACCACAAATGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-152s21c1
Sequence:CCGGATATGAGTCCACAGAACTTTCCTCGAGGAAAGTTCTGTGGACTCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023945
MS4A5 MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-384s1c1
Sequence:CCGGGCCTTCCTAATTGCAGTGAAACTCGAGTTTCACTGCAATTAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-423s1c1
Sequence:CCGGCTGATAATATTGAGCCGAATACTCGAGTATTCGGCTCAATATTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-252s1c1
Sequence:CCGGCTGTTTGGAATTATGACCTTTCTCGAGAAAGGTCATAATTCCAAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-475s1c1
Sequence:CCGGCTGGAATCATTCTCCTCACATCTCGAGATGTGAGGAGAATGATTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-565s1c1
Sequence:CCGGCTGTCCTGTTCTTGGGAATTTCTCGAGAAATTCCCAAGAACAGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-453s21c1
Sequence:CCGGCTTAGTGCCCTGGGAGCAATACTCGAGTATTGCTCCCAGGGCACTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-592s21c1
Sequence:CCGGCATTGATGACTTTCAGCATTACTCGAGTAATGCTGAAAGTCATCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-517s21c1
Sequence:CCGGACTACATTTGTGGTTATTCTCCTCGAGGAGAATAACCACAAATGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-152s21c1
Sequence:CCGGATATGAGTCCACAGAACTTTCCTCGAGGAAAGTTCTGTGGACTCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023945
MS4A5 MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-384s1c1
Sequence:CCGGGCCTTCCTAATTGCAGTGAAACTCGAGTTTCACTGCAATTAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-423s1c1
Sequence:CCGGCTGATAATATTGAGCCGAATACTCGAGTATTCGGCTCAATATTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-252s1c1
Sequence:CCGGCTGTTTGGAATTATGACCTTTCTCGAGAAAGGTCATAATTCCAAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-475s1c1
Sequence:CCGGCTGGAATCATTCTCCTCACATCTCGAGATGTGAGGAGAATGATTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023945.2-565s1c1
Sequence:CCGGCTGTCCTGTTCTTGGGAATTTCTCGAGAAATTCCCAAGAACAGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-453s21c1
Sequence:CCGGCTTAGTGCCCTGGGAGCAATACTCGAGTATTGCTCCCAGGGCACTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-592s21c1
Sequence:CCGGCATTGATGACTTTCAGCATTACTCGAGTAATGCTGAAAGTCATCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-517s21c1
Sequence:CCGGACTACATTTGTGGTTATTCTCCTCGAGGAGAATAACCACAAATGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023945.2-152s21c1
Sequence:CCGGATATGAGTCCACAGAACTTTCCTCGAGGAAAGTTCTGTGGACTCATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)