EMAIL THIS PAGE TO A FRIEND

MS4A6A

membrane-spanning 4-domains, subfamily A, member 6A

129 Gene Product Result for
Synonyms: 4SPAN3 4SPAN3.2 CD20L3 MS4A6 MST090 MSTP090
Gene ID:
Human(64231) Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]
Rat(293750) membrane-spanning 4-domains, subfamily A, member 6A
dog(612553) membrane-spanning 4-domains, subfamily A, member 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022349 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153181 MISSION® esiRNA esiRNA human MS4A6A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022349 Rosetta Predictions human pricing
NM_152851 Rosetta Predictions human pricing
NM_152852 Rosetta Predictions human pricing
XM_001075462 Rosetta Predictions rat pricing
XM_215145 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148750 predicted 235
2 SASI_Hs01_00148754 predicted 240
3 SASI_Hs02_00355635 predicted 246
4 SASI_Hs02_00355636 predicted 536
5 SASI_Hs02_00355637 predicted 983
6 SASI_Hs02_00355638 predicted 697
7 SASI_Hs02_00355639 predicted 908
8 SASI_Hs02_00355640 predicted 528
9 SASI_Hs02_00355641 predicted 702
10 SASI_Hs02_00355642 predicted 642
11 SASI_Hs01_00148745 predicted 285
12 SASI_Hs01_00148746 predicted 268
13 SASI_Hs01_00148747 predicted 278
14 SASI_Hs01_00148748 predicted 273
15 SASI_Hs01_00148749 predicted 282
16 SASI_Hs01_00148751 predicted 270
17 SASI_Hs01_00148752 predicted 280
18 SASI_Hs01_00148753 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022946 predicted 234
2 SASI_Hs01_00022950 predicted 243
3 SASI_Hs02_00366782 predicted 239
4 SASI_Hs02_00366783 predicted 533
5 SASI_Hs02_00366784 predicted 799
6 SASI_Hs02_00366785 predicted 533
7 SASI_Hs02_00366786 predicted 1044
8 SASI_Hs02_00366787 predicted 843
9 SASI_Hs02_00366788 predicted 643
10 SASI_Hs02_00366789 predicted 640
11 SASI_Hs01_00022941 predicted 291
12 SASI_Hs01_00022942 predicted 267
13 SASI_Hs01_00022943 predicted 277
14 SASI_Hs01_00022944 predicted 276
15 SASI_Hs01_00022945 predicted 280
16 SASI_Hs01_00022947 predicted 276
17 SASI_Hs01_00022948 predicted 285
18 SASI_Hs01_00022949 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073998 predicted 239
2 SASI_Hs01_00074002 predicted 245
3 SASI_Hs02_00366790 predicted 242
4 SASI_Hs02_00366791 predicted 533
5 SASI_Hs02_00366792 predicted 900
6 SASI_Hs02_00366793 predicted 703
7 SASI_Hs02_00366794 predicted 527
8 SASI_Hs02_00366795 predicted 701
9 SASI_Hs02_00366796 predicted 944
10 SASI_Hs02_00366797 predicted 642
11 SASI_Hs01_00073993 predicted 288
12 SASI_Hs01_00073994 predicted 271
13 SASI_Hs01_00073995 predicted 279
14 SASI_Hs01_00073996 predicted 276
15 SASI_Hs01_00073997 predicted 278
16 SASI_Hs01_00073999 predicted 277
17 SASI_Hs01_00074000 predicted 277
18 SASI_Hs01_00074001 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349814 predicted 858
2 SASI_Rn02_00349815 predicted 253
3 SASI_Rn02_00349816 predicted 264
4 SASI_Rn02_00349817 predicted 298
5 SASI_Rn02_00349818 predicted 826
6 SASI_Rn02_00349819 predicted 254
7 SASI_Rn02_00349820 predicted 298
8 SASI_Rn02_00349821 predicted 90
9 SASI_Rn02_00349822 predicted 134
10 SASI_Rn02_00349823 predicted 66
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375835 predicted 858
2 SASI_Rn02_00375836 predicted 252
3 SASI_Rn02_00375837 predicted 266
4 SASI_Rn02_00375838 predicted 296
5 SASI_Rn02_00375839 predicted 826
6 SASI_Rn02_00375840 predicted 257
7 SASI_Rn02_00375841 predicted 289
8 SASI_Rn02_00375842 predicted 83
9 SASI_Rn02_00375843 predicted 133
10 SASI_Rn02_00375844 predicted 61
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022349
MS4A6A MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 6A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022349.2-1051s21c1
Sequence:CCGGTGGCAATTGAGTAGCTGATAACTCGAGTTATCAGCTACTCAATTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022349.2-748s21c1
Sequence:CCGGTTATACCACGGACTGCTATACCTCGAGGTATAGCAGTCCGTGGTATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022349.2-1117s21c1
Sequence:CCGGACTGATTCAATCTTCCTATTTCTCGAGAAATAGGAAGATTGAATCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-362s1c1
Sequence:CCGGCACGCAGAAATCAAAGTTATTCTCGAGAATAACTTTGATTTCTGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-862s1c1
Sequence:CCGGGAAACAGGCTTACTCTGACTTCTCGAGAAGTCAGAGTAAGCCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-391s1c1
Sequence:CCGGCCAGATCTTGTGTGGCATGATCTCGAGATCATGCCACACAAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-644s1c1
Sequence:CCGGTCTGTCAAACAGGCCACCTTACTCGAGTAAGGTGGCCTGTTTGACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022349
MS4A6A MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 6A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022349.2-1051s21c1
Sequence:CCGGTGGCAATTGAGTAGCTGATAACTCGAGTTATCAGCTACTCAATTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022349.2-748s21c1
Sequence:CCGGTTATACCACGGACTGCTATACCTCGAGGTATAGCAGTCCGTGGTATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022349.2-1117s21c1
Sequence:CCGGACTGATTCAATCTTCCTATTTCTCGAGAAATAGGAAGATTGAATCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-362s1c1
Sequence:CCGGCACGCAGAAATCAAAGTTATTCTCGAGAATAACTTTGATTTCTGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-862s1c1
Sequence:CCGGGAAACAGGCTTACTCTGACTTCTCGAGAAGTCAGAGTAAGCCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-391s1c1
Sequence:CCGGCCAGATCTTGTGTGGCATGATCTCGAGATCATGCCACACAAGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-644s1c1
Sequence:CCGGTCTGTCAAACAGGCCACCTTACTCGAGTAAGGTGGCCTGTTTGACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022349
MS4A6A MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 6A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022349.2-1051s21c1
Sequence:CCGGTGGCAATTGAGTAGCTGATAACTCGAGTTATCAGCTACTCAATTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022349.2-748s21c1
Sequence:CCGGTTATACCACGGACTGCTATACCTCGAGGTATAGCAGTCCGTGGTATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022349.2-1117s21c1
Sequence:CCGGACTGATTCAATCTTCCTATTTCTCGAGAAATAGGAAGATTGAATCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-362s1c1
Sequence:CCGGCACGCAGAAATCAAAGTTATTCTCGAGAATAACTTTGATTTCTGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-862s1c1
Sequence:CCGGGAAACAGGCTTACTCTGACTTCTCGAGAAGTCAGAGTAAGCCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-391s1c1
Sequence:CCGGCCAGATCTTGTGTGGCATGATCTCGAGATCATGCCACACAAGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022349.2-644s1c1
Sequence:CCGGTCTGTCAAACAGGCCACCTTACTCGAGTAAGGTGGCCTGTTTGACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)