EMAIL THIS PAGE TO A FRIEND

MS4A6E

membrane-spanning 4-domains, subfamily A, member 6E

28 Gene Product Result for
Species: Human MS4A6E(245802)
UniProtKB ID: Q96DS6, Q3MIL2, Q8NE56, Q96PG4, Q96PG5
Gene ID:
Human(245802) Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.3, among a cluster of family members. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA076623 Anti-MS4A6E antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139249 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127391 MISSION® esiRNA esiRNA human MS4A6E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139249 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163906 predicted 255
2 SASI_Hs01_00163907 predicted 223
3 SASI_Hs01_00163908 predicted 250
4 SASI_Hs01_00163909 predicted 367
5 SASI_Hs01_00163911 predicted 229
6 SASI_Hs02_00364252 predicted 220
7 SASI_Hs01_00163912 predicted 384
8 SASI_Hs01_00163913 predicted 300
9 SASI_Hs01_00163914 predicted 392
10 SASI_Hs01_00163915 predicted 380
11 SASI_Hs01_00163910 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139249
MS4A6E MISSION shRNA Bacterial Glycerol Stock
membrane-spanning 4-domains, subfamily A, member 6E
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-383s1c1
Sequence:CCGGGATGCTGGTTTCTACTGTGTTCTCGAGAACACAGTAGAAACCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-53s1c1
Sequence:CCGGGCTCCCATCAAATGTCATCAACTCGAGTTGATGACATTTGATGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-436s1c1
Sequence:CCGGTGCAGTGGAAACAGACTGTCTCTCGAGAGACAGTCTGTTTCCACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-285s1c1
Sequence:CCGGGATATACCAACCAGACTTCTTCTCGAGAAGAAGTCTGGTTGGTATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-124s1c1
Sequence:CCGGTGAAGAAACGTCTACAGGCAACTCGAGTTGCCTGTAGACGTTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-298s21c1
Sequence:CCGGGACTTCTTCTTTCTTATGATTCTCGAGAATCATAAGAAAGAAGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-383s21c1
Sequence:CCGGGATGCTGGTTTCTACTGTGTTCTCGAGAACACAGTAGAAACCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139249.2-487s21c1
Sequence:CCGGCGACTCATGATGCTGGATATGCTCGAGCATATCCAGCATCATGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-455s21c1
Sequence:CCGGCTGACTTCCCTGGTTACTCATCTCGAGATGAGTAACCAGGGAAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-337s21c1
Sequence:CCGGTGGACTGCCATAGAGCCAAAGCTCGAGCTTTGGCTCTATGGCAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-312s21c1
Sequence:CCGGTATGATTATCATTCACCTTACCTCGAGGTAAGGTGAATGATAATCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-231s21c1
Sequence:CCGGGTCAACCCGGCTGCATTAAATCTCGAGATTTAATGCAGCCGGGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139249.2-472s21c1
Sequence:CCGGTCATGTCCTCAAAGACGACTCCTCGAGGAGTCGTCTTTGAGGACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139249
MS4A6E MISSION shRNA shRNA Plasmid DNA
membrane-spanning 4-domains, subfamily A, member 6E
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-383s1c1
Sequence:CCGGGATGCTGGTTTCTACTGTGTTCTCGAGAACACAGTAGAAACCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-53s1c1
Sequence:CCGGGCTCCCATCAAATGTCATCAACTCGAGTTGATGACATTTGATGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-436s1c1
Sequence:CCGGTGCAGTGGAAACAGACTGTCTCTCGAGAGACAGTCTGTTTCCACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-285s1c1
Sequence:CCGGGATATACCAACCAGACTTCTTCTCGAGAAGAAGTCTGGTTGGTATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-124s1c1
Sequence:CCGGTGAAGAAACGTCTACAGGCAACTCGAGTTGCCTGTAGACGTTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-298s21c1
Sequence:CCGGGACTTCTTCTTTCTTATGATTCTCGAGAATCATAAGAAAGAAGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-383s21c1
Sequence:CCGGGATGCTGGTTTCTACTGTGTTCTCGAGAACACAGTAGAAACCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139249.2-487s21c1
Sequence:CCGGCGACTCATGATGCTGGATATGCTCGAGCATATCCAGCATCATGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-455s21c1
Sequence:CCGGCTGACTTCCCTGGTTACTCATCTCGAGATGAGTAACCAGGGAAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-337s21c1
Sequence:CCGGTGGACTGCCATAGAGCCAAAGCTCGAGCTTTGGCTCTATGGCAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-312s21c1
Sequence:CCGGTATGATTATCATTCACCTTACCTCGAGGTAAGGTGAATGATAATCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-231s21c1
Sequence:CCGGGTCAACCCGGCTGCATTAAATCTCGAGATTTAATGCAGCCGGGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139249.2-472s21c1
Sequence:CCGGTCATGTCCTCAAAGACGACTCCTCGAGGAGTCGTCTTTGAGGACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139249
MS4A6E MISSION shRNA Lentiviral Transduction Particles
membrane-spanning 4-domains, subfamily A, member 6E
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-383s1c1
Sequence:CCGGGATGCTGGTTTCTACTGTGTTCTCGAGAACACAGTAGAAACCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-53s1c1
Sequence:CCGGGCTCCCATCAAATGTCATCAACTCGAGTTGATGACATTTGATGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-436s1c1
Sequence:CCGGTGCAGTGGAAACAGACTGTCTCTCGAGAGACAGTCTGTTTCCACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-285s1c1
Sequence:CCGGGATATACCAACCAGACTTCTTCTCGAGAAGAAGTCTGGTTGGTATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139249.2-124s1c1
Sequence:CCGGTGAAGAAACGTCTACAGGCAACTCGAGTTGCCTGTAGACGTTTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-298s21c1
Sequence:CCGGGACTTCTTCTTTCTTATGATTCTCGAGAATCATAAGAAAGAAGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-383s21c1
Sequence:CCGGGATGCTGGTTTCTACTGTGTTCTCGAGAACACAGTAGAAACCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139249.2-487s21c1
Sequence:CCGGCGACTCATGATGCTGGATATGCTCGAGCATATCCAGCATCATGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-455s21c1
Sequence:CCGGCTGACTTCCCTGGTTACTCATCTCGAGATGAGTAACCAGGGAAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-337s21c1
Sequence:CCGGTGGACTGCCATAGAGCCAAAGCTCGAGCTTTGGCTCTATGGCAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-312s21c1
Sequence:CCGGTATGATTATCATTCACCTTACCTCGAGGTAAGGTGAATGATAATCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139249.2-231s21c1
Sequence:CCGGGTCAACCCGGCTGCATTAAATCTCGAGATTTAATGCAGCCGGGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139249.2-472s21c1
Sequence:CCGGTCATGTCCTCAAAGACGACTCCTCGAGGAGTCGTCTTTGAGGACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)