EMAIL THIS PAGE TO A FRIEND

MSANTD1

Myb/SANT-like DNA-binding domain containing 1

57 Gene Product Result for
Synonyms: C4orf44
UniProtKB ID: Q6ZTZ1, C9J6V0
Gene ID:
Mouse(403174) Myb/SANT-like DNA-binding domain containing 1
Rat(498394) Myb/SANT-like DNA-binding domain containing 1
dog(610482) Myb/SANT-like DNA-binding domain containing 1
cow(614978) Myb/SANT-like DNA-binding domain containing 1
domestic guinea pig(100718348) Myb/SANT-like DNA-binding domain containing 1
naked mole-rat(101726748) Myb/SANT-like DNA-binding domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042690 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012982 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012982 Rosetta Predictions human pricing
NM_001042690 Rosetta Predictions human pricing
NM_001109089 Rosetta Predictions rat pricing
NM_207277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018827 predicted 414
2 SASI_Hs02_00306284 predicted 487
3 SASI_Hs01_00018828 predicted 680
4 SASI_Hs01_00018829 predicted 545
5 SASI_Hs01_00018832 predicted 379
6 SASI_Hs01_00018830 predicted 334
7 SASI_Hs02_00306285 predicted 546
8 SASI_Hs02_00306286 predicted 542
9 SASI_Hs01_00018833 predicted 474
10 SASI_Hs02_00306287 predicted 309
11 SASI_Hs01_00018825 predicted 1480
12 SASI_Hs01_00018826 predicted 1315
13 SASI_Hs01_00018831 predicted 1302
14 SASI_Hs01_00018834 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310985 predicted 410
2 SASI_Hs02_00310986 predicted 483
3 SASI_Hs02_00310987 predicted 681
4 SASI_Hs02_00310988 predicted 545
5 SASI_Hs02_00310989 predicted 381
6 SASI_Hs02_00310990 predicted 338
7 SASI_Hs02_00310991 predicted 546
8 SASI_Hs02_00310992 predicted 541
9 SASI_Hs02_00310993 predicted 480
10 SASI_Hs02_00310994 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245020 predicted 419
2 SASI_Rn02_00245021 predicted 286
3 SASI_Rn02_00245022 predicted 641
4 SASI_Rn02_00245023 predicted 456
5 SASI_Rn02_00245024 predicted 246
6 SASI_Rn02_00245025 predicted 625
7 SASI_Rn02_00245026 predicted 250
8 SASI_Rn02_00245027 predicted 267
9 SASI_Rn02_00245028 predicted 211
10 SASI_Rn02_00245029 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111650 predicted 2047
2 SASI_Mm01_00111651 predicted 1760
3 SASI_Mm01_00111652 predicted 1871
4 SASI_Mm02_00352039 predicted 2511
5 SASI_Mm01_00111653 predicted 2079
6 SASI_Mm01_00111654 predicted 2041
7 SASI_Mm01_00111655 predicted 2466
8 SASI_Mm01_00111656 predicted 2258
9 SASI_Mm01_00111657 predicted 2245
10 SASI_Mm01_00111658 predicted 1864
11 SASI_Mm01_00111659 predicted 2267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042690
MSANTD1 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000434938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042690.1-1303s21c1
Sequence:CCGGTGTCGTTACTATCAATGATACCTCGAGGTATCATTGATAGTAACGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042690.1-393s21c1
Sequence:CCGGCAACGCCAAGGTGTACGAGAACTCGAGTTCTCGTACACCTTGGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042690.1-1000s21c1
Sequence:CCGGATCACCAAGTCCAGCGTCTAGCTCGAGCTAGACGCTGGACTTGGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042690.1-1325s21c1
Sequence:CCGCTGACGTGGCTTTGATATTAAACTCGAGTTTAATATCAAAGCCACGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042690
MSANTD1 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000434938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042690.1-1303s21c1
Sequence:CCGGTGTCGTTACTATCAATGATACCTCGAGGTATCATTGATAGTAACGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042690.1-393s21c1
Sequence:CCGGCAACGCCAAGGTGTACGAGAACTCGAGTTCTCGTACACCTTGGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042690.1-1000s21c1
Sequence:CCGGATCACCAAGTCCAGCGTCTAGCTCGAGCTAGACGCTGGACTTGGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042690.1-1325s21c1
Sequence:CCGCTGACGTGGCTTTGATATTAAACTCGAGTTTAATATCAAAGCCACGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042690
MSANTD1 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000434938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042690.1-1303s21c1
Sequence:CCGGTGTCGTTACTATCAATGATACCTCGAGGTATCATTGATAGTAACGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042690.1-393s21c1
Sequence:CCGGCAACGCCAAGGTGTACGAGAACTCGAGTTCTCGTACACCTTGGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042690.1-1000s21c1
Sequence:CCGGATCACCAAGTCCAGCGTCTAGCTCGAGCTAGACGCTGGACTTGGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042690.1-1325s21c1
Sequence:CCGCTGACGTGGCTTTGATATTAAACTCGAGTTTAATATCAAAGCCACGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207277
MSANTD1 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207277.1-2519s21c1
Sequence:CCGGTCCATGGAGAGAATGCCAGGTCTCGAGACCTGGCATTCTCTCCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-1990s21c1
Sequence:CCGGCTTCCAGTACAGGAAATTAAACTCGAGTTTAATTTCCTGTACTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-2481s21c1
Sequence:CCGGGCCTACTGGAGAAGATCATTGCTCGAGCAATGATCTTCTCCAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-2182s21c1
Sequence:CCGGCCCTCTGTACTTACCGTATACCTCGAGGTATACGGTAAGTACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2491s1c1
Sequence:CCGGGAAGATCATTGCCAAGTCCAACTCGAGTTGGACTTGGCAATGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2056s1c1
Sequence:CCGGCCTAGCCATTGATAGGATTCTCTCGAGAGAATCCTATCAATGGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2014s1c1
Sequence:CCGGCATGACAGATAGCGAGTCCATCTCGAGATGGACTCGCTATCTGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207277
MSANTD1 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207277.1-2519s21c1
Sequence:CCGGTCCATGGAGAGAATGCCAGGTCTCGAGACCTGGCATTCTCTCCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-1990s21c1
Sequence:CCGGCTTCCAGTACAGGAAATTAAACTCGAGTTTAATTTCCTGTACTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-2481s21c1
Sequence:CCGGGCCTACTGGAGAAGATCATTGCTCGAGCAATGATCTTCTCCAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-2182s21c1
Sequence:CCGGCCCTCTGTACTTACCGTATACCTCGAGGTATACGGTAAGTACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2491s1c1
Sequence:CCGGGAAGATCATTGCCAAGTCCAACTCGAGTTGGACTTGGCAATGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2056s1c1
Sequence:CCGGCCTAGCCATTGATAGGATTCTCTCGAGAGAATCCTATCAATGGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2014s1c1
Sequence:CCGGCATGACAGATAGCGAGTCCATCTCGAGATGGACTCGCTATCTGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207277
MSANTD1 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207277.1-2519s21c1
Sequence:CCGGTCCATGGAGAGAATGCCAGGTCTCGAGACCTGGCATTCTCTCCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-1990s21c1
Sequence:CCGGCTTCCAGTACAGGAAATTAAACTCGAGTTTAATTTCCTGTACTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-2481s21c1
Sequence:CCGGGCCTACTGGAGAAGATCATTGCTCGAGCAATGATCTTCTCCAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207277.1-2182s21c1
Sequence:CCGGCCCTCTGTACTTACCGTATACCTCGAGGTATACGGTAAGTACAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2491s1c1
Sequence:CCGGGAAGATCATTGCCAAGTCCAACTCGAGTTGGACTTGGCAATGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2056s1c1
Sequence:CCGGCCTAGCCATTGATAGGATTCTCTCGAGAGAATCCTATCAATGGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207277.1-2014s1c1
Sequence:CCGGCATGACAGATAGCGAGTCCATCTCGAGATGGACTCGCTATCTGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012982
MSANTD1 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000136807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-480s1c1
Sequence:CCGGCACCAACATGACCTTCCAGTACTCGAGTACTGGAAGGTCATGTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-459s1c1
Sequence:CCGGCGAGGAGATCAAGATCAAGATCTCGAGATCTTGATCTTGATCTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012982.1-1115s1c1
Sequence:CCGGGCCAATTTCTGACGCTACATTCTCGAGAATGTAGCGTCAGAAATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-468s1c1
Sequence:CCGGCAAGATCAAGATCACCAACATCTCGAGATGTTGGTGATCTTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012982
MSANTD1 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000136807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-480s1c1
Sequence:CCGGCACCAACATGACCTTCCAGTACTCGAGTACTGGAAGGTCATGTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-459s1c1
Sequence:CCGGCGAGGAGATCAAGATCAAGATCTCGAGATCTTGATCTTGATCTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012982.1-1115s1c1
Sequence:CCGGGCCAATTTCTGACGCTACATTCTCGAGAATGTAGCGTCAGAAATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-468s1c1
Sequence:CCGGCAAGATCAAGATCACCAACATCTCGAGATGTTGGTGATCTTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012982
MSANTD1 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000136807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-480s1c1
Sequence:CCGGCACCAACATGACCTTCCAGTACTCGAGTACTGGAAGGTCATGTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-459s1c1
Sequence:CCGGCGAGGAGATCAAGATCAAGATCTCGAGATCTTGATCTTGATCTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012982.1-1115s1c1
Sequence:CCGGGCCAATTTCTGACGCTACATTCTCGAGAATGTAGCGTCAGAAATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012982.1-468s1c1
Sequence:CCGGCAAGATCAAGATCACCAACATCTCGAGATGTTGGTGATCTTGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)