EMAIL THIS PAGE TO A FRIEND

MSANTD2

Myb/SANT-like DNA-binding domain containing 2

105 Gene Product Result for
Synonyms: C11orf61
UniProtKB ID: Q6P1R3, B3KRY6, Q9H042, Q9H5K8
Gene ID:
Mouse(235184) Myb/SANT-like DNA-binding domain containing 2
Rat(500974) Myb/SANT-like DNA-binding domain containing 2
naked mole-rat(101722694) Myb/SANT-like DNA-binding domain containing 2
domestic guinea pig(100721812) Myb/SANT-like DNA-binding domain containing 2
sheep(101108700) Myb/SANT-like DNA-binding domain containing 2
dog(612770) Myb/SANT-like DNA-binding domain containing 2
cow(613830) Myb/SANT-like DNA-binding domain containing 2
domestic cat(101084473) Myb/SANT-like DNA-binding domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024631 Rosetta Predictions human pricing
XM_576384 Rosetta Predictions rat pricing
XR_005433 Rosetta Predictions rat pricing
XR_009636 Rosetta Predictions rat pricing
NM_146222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357011 predicted 1640
2 SASI_Hs01_00188880 predicted 1247
3 SASI_Hs01_00188881 predicted 1026
4 SASI_Hs01_00188883 predicted 1034
5 SASI_Hs01_00188884 predicted 1125
6 SASI_Hs02_00357012 predicted 1432
7 SASI_Hs01_00188885 predicted 1447
8 SASI_Hs01_00188886 predicted 700
9 SASI_Hs01_00188887 predicted 548
10 SASI_Hs01_00188888 predicted 1568
11 SASI_Hs01_00188882 predicted 708
12 SASI_Hs01_00188889 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171588 predicted 988
2 SASI_Rn01_00171589 predicted 873
3 SASI_Rn01_00171590 predicted 893
4 SASI_Rn01_00171591 predicted 794
5 SASI_Rn01_00171592 predicted 1291
6 SASI_Rn01_00171593 predicted 982
7 SASI_Rn01_00171594 predicted 803
8 SASI_Rn01_00171595 predicted 1099
9 SASI_Rn01_00171596 predicted 1586
10 SASI_Rn01_00171597 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409184 predicted 2051
2 SASI_Rn02_00409185 predicted 1232
3 SASI_Rn02_00409186 predicted 1101
4 SASI_Rn02_00409187 predicted 1129
5 SASI_Rn02_00409188 predicted 1021
6 SASI_Rn02_00409189 predicted 1520
7 SASI_Rn02_00409190 predicted 1031
8 SASI_Rn02_00409191 predicted 2218
9 SASI_Rn02_00409192 predicted 1330
10 SASI_Rn02_00409193 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420532 predicted 2046
2 SASI_Rn02_00420533 predicted 1224
3 SASI_Rn02_00420534 predicted 1106
4 SASI_Rn02_00420535 predicted 1138
5 SASI_Rn02_00420536 predicted 1023
6 SASI_Rn02_00420537 predicted 1519
7 SASI_Rn02_00420538 predicted 1035
8 SASI_Rn02_00420539 predicted 2223
9 SASI_Rn02_00420540 predicted 1331
10 SASI_Rn02_00420541 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077499 predicted 969
2 SASI_Mm01_00077500 predicted 1501
3 SASI_Mm01_00077501 predicted 763
4 SASI_Mm01_00077502 predicted 846
5 SASI_Mm01_00077503 predicted 1259
6 SASI_Mm01_00077504 predicted 748
7 SASI_Mm01_00077505 predicted 872
8 SASI_Mm01_00077506 predicted 1575
9 SASI_Mm01_00077507 predicted 1068
10 SASI_Mm02_00341923 predicted 1415
11 SASI_Mm01_00077498 predicted 1777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024631
VALIDATED
MSANTD2 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024631.2-1743s21c1
Sequence:CCGGTTTGAGCAAGCAAGATATATACTCGAGTATATATCTTGCTTGCTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024631.2-1317s21c1
Sequence:CCGGACTCTACAGCAGTGCTTATTTCTCGAGAAATAAGCACTGCTGTAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024631.2-2044s21c1
Sequence:CCGGATATCACCCTTAGCTACTATTCTCGAGAATAGTAGCTAAGGGTGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-1434s1c1
Sequence:CCGGCCCAAATCCATCTACATCAAACTCGAGTTTGATGTAGATGGATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024631.1-1248s1c1
Sequence:CCGGGCCTCATTACAGGTGGAAATACTCGAGTATTTCCACCTGTAATGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024631.1-550s1c1
Sequence:CCGGGCAGCACTATGGAGGACTATTCTCGAGAATAGTCCTCCATAGTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-642s1c1
Sequence:CCGGCCTGTCACAAAGAGAACATTACTCGAGTAATGTTCTCTTTGTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-1138s1c1
Sequence:CCGGCCATTGGCTATGAAGAATGTACTCGAGTACATTCTTCATAGCCAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024631.2-925s21c1
Sequence:CCGGAGCCTGAAGGACGGATCATTACTCGAGTAATGATCCGTCCTTCAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024631
VALIDATED
MSANTD2 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024631.2-1743s21c1
Sequence:CCGGTTTGAGCAAGCAAGATATATACTCGAGTATATATCTTGCTTGCTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024631.2-1317s21c1
Sequence:CCGGACTCTACAGCAGTGCTTATTTCTCGAGAAATAAGCACTGCTGTAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024631.2-2044s21c1
Sequence:CCGGATATCACCCTTAGCTACTATTCTCGAGAATAGTAGCTAAGGGTGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-1434s1c1
Sequence:CCGGCCCAAATCCATCTACATCAAACTCGAGTTTGATGTAGATGGATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024631.1-1248s1c1
Sequence:CCGGGCCTCATTACAGGTGGAAATACTCGAGTATTTCCACCTGTAATGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024631.1-550s1c1
Sequence:CCGGGCAGCACTATGGAGGACTATTCTCGAGAATAGTCCTCCATAGTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-642s1c1
Sequence:CCGGCCTGTCACAAAGAGAACATTACTCGAGTAATGTTCTCTTTGTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-1138s1c1
Sequence:CCGGCCATTGGCTATGAAGAATGTACTCGAGTACATTCTTCATAGCCAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024631.2-925s21c1
Sequence:CCGGAGCCTGAAGGACGGATCATTACTCGAGTAATGATCCGTCCTTCAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024631
VALIDATED
MSANTD2 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024631.2-1743s21c1
Sequence:CCGGTTTGAGCAAGCAAGATATATACTCGAGTATATATCTTGCTTGCTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024631.2-1317s21c1
Sequence:CCGGACTCTACAGCAGTGCTTATTTCTCGAGAAATAAGCACTGCTGTAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024631.2-2044s21c1
Sequence:CCGGATATCACCCTTAGCTACTATTCTCGAGAATAGTAGCTAAGGGTGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-1434s1c1
Sequence:CCGGCCCAAATCCATCTACATCAAACTCGAGTTTGATGTAGATGGATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024631.1-1248s1c1
Sequence:CCGGGCCTCATTACAGGTGGAAATACTCGAGTATTTCCACCTGTAATGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024631.1-550s1c1
Sequence:CCGGGCAGCACTATGGAGGACTATTCTCGAGAATAGTCCTCCATAGTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-642s1c1
Sequence:CCGGCCTGTCACAAAGAGAACATTACTCGAGTAATGTTCTCTTTGTGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024631.1-1138s1c1
Sequence:CCGGCCATTGGCTATGAAGAATGTACTCGAGTACATTCTTCATAGCCAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024631.2-925s21c1
Sequence:CCGGAGCCTGAAGGACGGATCATTACTCGAGTAATGATCCGTCCTTCAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146222
MSANTD2 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146222.2-1948s21c1
Sequence:CCGGGCCTTGATATAAGCAAATGTACTCGAGTACATTTGCTTATATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-746s21c1
Sequence:CCGGGCTATCCAACAGATCAGGAATCTCGAGATTCCTGATCTGTTGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-835s21c1
Sequence:CCGGCGAGATACCATGCAGAATATTCTCGAGAATATTCTGCATGGTATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-834s1c1
Sequence:CCGGGCGAGATACCATGCAGAATATCTCGAGATATTCTGCATGGTATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-876s21c1
Sequence:CCGGGCAGTTGAAATGGGAACTGTTCTCGAGAACAGTTCCCATTTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146222.2-1948s1c1
Sequence:CCGGGCCTTGATATAAGCAAATGTACTCGAGTACATTTGCTTATATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-835s1c1
Sequence:CCGGCGAGATACCATGCAGAATATTCTCGAGAATATTCTGCATGGTATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-876s1c1
Sequence:CCGGGCAGTTGAAATGGGAACTGTTCTCGAGAACAGTTCCCATTTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-746s1c1
Sequence:CCGGGCTATCCAACAGATCAGGAATCTCGAGATTCCTGATCTGTTGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146222
MSANTD2 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146222.2-1948s21c1
Sequence:CCGGGCCTTGATATAAGCAAATGTACTCGAGTACATTTGCTTATATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-746s21c1
Sequence:CCGGGCTATCCAACAGATCAGGAATCTCGAGATTCCTGATCTGTTGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-835s21c1
Sequence:CCGGCGAGATACCATGCAGAATATTCTCGAGAATATTCTGCATGGTATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-834s1c1
Sequence:CCGGGCGAGATACCATGCAGAATATCTCGAGATATTCTGCATGGTATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-876s21c1
Sequence:CCGGGCAGTTGAAATGGGAACTGTTCTCGAGAACAGTTCCCATTTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146222.2-1948s1c1
Sequence:CCGGGCCTTGATATAAGCAAATGTACTCGAGTACATTTGCTTATATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-835s1c1
Sequence:CCGGCGAGATACCATGCAGAATATTCTCGAGAATATTCTGCATGGTATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-876s1c1
Sequence:CCGGGCAGTTGAAATGGGAACTGTTCTCGAGAACAGTTCCCATTTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-746s1c1
Sequence:CCGGGCTATCCAACAGATCAGGAATCTCGAGATTCCTGATCTGTTGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146222
MSANTD2 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146222.2-1948s21c1
Sequence:CCGGGCCTTGATATAAGCAAATGTACTCGAGTACATTTGCTTATATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-746s21c1
Sequence:CCGGGCTATCCAACAGATCAGGAATCTCGAGATTCCTGATCTGTTGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-835s21c1
Sequence:CCGGCGAGATACCATGCAGAATATTCTCGAGAATATTCTGCATGGTATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-834s1c1
Sequence:CCGGGCGAGATACCATGCAGAATATCTCGAGATATTCTGCATGGTATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146222.2-876s21c1
Sequence:CCGGGCAGTTGAAATGGGAACTGTTCTCGAGAACAGTTCCCATTTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146222.2-1948s1c1
Sequence:CCGGGCCTTGATATAAGCAAATGTACTCGAGTACATTTGCTTATATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-835s1c1
Sequence:CCGGCGAGATACCATGCAGAATATTCTCGAGAATATTCTGCATGGTATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-876s1c1
Sequence:CCGGGCAGTTGAAATGGGAACTGTTCTCGAGAACAGTTCCCATTTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146222.2-746s1c1
Sequence:CCGGGCTATCCAACAGATCAGGAATCTCGAGATTCCTGATCTGTTGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)