EMAIL THIS PAGE TO A FRIEND

MSANTD3

Myb/SANT-like DNA-binding domain containing 3

78 Gene Product Result for
Synonyms: C9orf30
UniProtKB ID: Q96H12, Q5T726, Q5T727, Q5T728
Gene ID:
Mouse(66665) Myb/SANT-like DNA-binding domain containing 3
Rat(362516) Myb/SANT-like DNA-binding domain containing 3
cow(534309) Myb/SANT-like DNA-binding domain containing 3
domestic guinea pig(100718680) Myb/SANT-like DNA-binding domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080655 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080655 Rosetta Predictions human pricing
NM_001108664 Rosetta Predictions rat pricing
NM_028137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189759 predicted 286
2 SASI_Hs01_00189765 predicted 367
3 SASI_Hs02_00362404 predicted 662
4 SASI_Hs01_00189758 predicted 569
5 SASI_Hs01_00189760 predicted 521
6 SASI_Hs02_00362405 predicted 628
7 SASI_Hs01_00189761 predicted 480
8 SASI_Hs02_00362406 predicted 934
9 SASI_Hs01_00189762 predicted 683
10 SASI_Hs01_00189763 predicted 584
11 SASI_Hs01_00189764 predicted 518
12 SASI_Hs01_00189766 predicted 879
13 SASI_Hs01_00189767 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240855 predicted 649
2 SASI_Rn02_00240856 predicted 351
3 SASI_Rn02_00240857 predicted 331
4 SASI_Rn02_00240858 predicted 681
5 SASI_Rn02_00240859 predicted 879
6 SASI_Rn02_00240860 predicted 807
7 SASI_Rn02_00240861 predicted 981
8 SASI_Rn02_00240862 predicted 997
9 SASI_Rn02_00240863 predicted 961
10 SASI_Rn02_00240864 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184322 predicted 610
2 SASI_Mm01_00184323 predicted 626
3 SASI_Mm01_00184324 predicted 327
4 SASI_Mm01_00184325 predicted 661
5 SASI_Mm01_00184326 predicted 616
6 SASI_Mm01_00184327 predicted 595
7 SASI_Mm01_00184328 predicted 434
8 SASI_Mm01_00184329 predicted 917
9 SASI_Mm01_00184330 predicted 939
10 SASI_Mm01_00184331 predicted 907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028137
VALIDATED
MSANTD3 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-740s1c1
Sequence:CCGGGATCCAAATGAACGAGGTGCACTCGAGTGCACCTCGTTCATTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-713s1c1
Sequence:CCGGGCAGATGTCCATCTTACAGCTCTCGAGAGCTGTAAGATGGACATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-626s1c1
Sequence:CCGGCGTCAGGATAACCGCCAATAACTCGAGTTATTGGCGGTTATCCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028137.1-197s1c1
Sequence:CCGGGTTGGAATGCAAGAAGAGCGACTCGAGTCGCTCTTCTTGCATTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-731s1c1
Sequence:CCGGGCTGCAGCTGATCCAAATGAACTCGAGTTCATTTGGATCAGCTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-667s1c1
Sequence:CCGGCTCAGGAAGGTGCTTTAAAGACTCGAGTCTTTAAAGCACCTTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-1148s1c1
Sequence:CCGGCGTGCTATAATTCTGAATGTACTCGAGTACATTCAGAATTATAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-546s1c1
Sequence:CCGGGAACTGTGCGAGGATGAGAAACTCGAGTTTCTCATCCTCGCACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028137.3-706s21c1
Sequence:CCGGCCATCAGCAGATGTCCATCTTCTCGAGAAGATGGACATCTGCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028137.2-1050s1c1
Sequence:CCGGCACTTATTTAAGGATACATTCCTCGAGGAATGTATCCTTAAATAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028137.2-940s1c1
Sequence:CCGGGATGGCTCCCTTGTAGTTAATCTCGAGATTAACTACAAGGGAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028137.3-1036s21c1
Sequence:CCGGAGAGTGGTAGTAGTCACTTATCTCGAGATAAGTGACTACTACCACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028137.3-939s21c1
Sequence:CCGGGGATGGCTCCCTTGTAGTTAACTCGAGTTAACTACAAGGGAGCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028137
VALIDATED
MSANTD3 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-740s1c1
Sequence:CCGGGATCCAAATGAACGAGGTGCACTCGAGTGCACCTCGTTCATTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-713s1c1
Sequence:CCGGGCAGATGTCCATCTTACAGCTCTCGAGAGCTGTAAGATGGACATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-626s1c1
Sequence:CCGGCGTCAGGATAACCGCCAATAACTCGAGTTATTGGCGGTTATCCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028137.1-197s1c1
Sequence:CCGGGTTGGAATGCAAGAAGAGCGACTCGAGTCGCTCTTCTTGCATTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-731s1c1
Sequence:CCGGGCTGCAGCTGATCCAAATGAACTCGAGTTCATTTGGATCAGCTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-667s1c1
Sequence:CCGGCTCAGGAAGGTGCTTTAAAGACTCGAGTCTTTAAAGCACCTTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-1148s1c1
Sequence:CCGGCGTGCTATAATTCTGAATGTACTCGAGTACATTCAGAATTATAGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-546s1c1
Sequence:CCGGGAACTGTGCGAGGATGAGAAACTCGAGTTTCTCATCCTCGCACAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028137.3-706s21c1
Sequence:CCGGCCATCAGCAGATGTCCATCTTCTCGAGAAGATGGACATCTGCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028137.2-1050s1c1
Sequence:CCGGCACTTATTTAAGGATACATTCCTCGAGGAATGTATCCTTAAATAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028137.2-940s1c1
Sequence:CCGGGATGGCTCCCTTGTAGTTAATCTCGAGATTAACTACAAGGGAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028137.3-1036s21c1
Sequence:CCGGAGAGTGGTAGTAGTCACTTATCTCGAGATAAGTGACTACTACCACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028137.3-939s21c1
Sequence:CCGGGGATGGCTCCCTTGTAGTTAACTCGAGTTAACTACAAGGGAGCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028137
VALIDATED
MSANTD3 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-740s1c1
Sequence:CCGGGATCCAAATGAACGAGGTGCACTCGAGTGCACCTCGTTCATTTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-713s1c1
Sequence:CCGGGCAGATGTCCATCTTACAGCTCTCGAGAGCTGTAAGATGGACATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028137.1-626s1c1
Sequence:CCGGCGTCAGGATAACCGCCAATAACTCGAGTTATTGGCGGTTATCCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028137.1-197s1c1
Sequence:CCGGGTTGGAATGCAAGAAGAGCGACTCGAGTCGCTCTTCTTGCATTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-731s1c1
Sequence:CCGGGCTGCAGCTGATCCAAATGAACTCGAGTTCATTTGGATCAGCTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-667s1c1
Sequence:CCGGCTCAGGAAGGTGCTTTAAAGACTCGAGTCTTTAAAGCACCTTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-1148s1c1
Sequence:CCGGCGTGCTATAATTCTGAATGTACTCGAGTACATTCAGAATTATAGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028137.1-546s1c1
Sequence:CCGGGAACTGTGCGAGGATGAGAAACTCGAGTTTCTCATCCTCGCACAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028137.3-706s21c1
Sequence:CCGGCCATCAGCAGATGTCCATCTTCTCGAGAAGATGGACATCTGCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028137.2-1050s1c1
Sequence:CCGGCACTTATTTAAGGATACATTCCTCGAGGAATGTATCCTTAAATAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028137.2-940s1c1
Sequence:CCGGGATGGCTCCCTTGTAGTTAATCTCGAGATTAACTACAAGGGAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028137.3-1036s21c1
Sequence:CCGGAGAGTGGTAGTAGTCACTTATCTCGAGATAAGTGACTACTACCACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028137.3-939s21c1
Sequence:CCGGGGATGGCTCCCTTGTAGTTAACTCGAGTTAACTACAAGGGAGCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080655
VALIDATED
MSANTD3 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-627s1c1
Sequence:CCGGCCTCTCAGGAAGGTGCTTTAACTCGAGTTAAAGCACCTTCCTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-277s1c1
Sequence:CCGGGAAGAAGTGCTGGGAGAACATCTCGAGATGTTCTCCCAGCACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-323s1c1
Sequence:CCGGGCCCATGAAAGGAGAGAGAAACTCGAGTTTCTCTCTCCTTTCATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-656s1c1
Sequence:CCGGCATGAGGAAGAACACCATCAACTCGAGTTGATGGTGTTCTTCCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-930s1c1
Sequence:CCGGGTTGGCAAAGAATGTCTGGAACTCGAGTTCCAGACATTCTTTGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-479s1c1
Sequence:CCGGGCCCAAGAATCATTTGCTGTTCTCGAGAACAGCAAATGATTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-517s1c1
Sequence:CCGGCGATGATGAGAAAGAGTTCATCTCGAGATGAACTCTTTCTCATCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-1002s1c1
Sequence:CCGGGAGTGGTAGTAGTCACTTATTCTCGAGAATAAGTGACTACTACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-659s1c1
Sequence:CCGGGAGGAAGAACACCATCAACAACTCGAGTTGTTGATGGTGTTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-587s1c1
Sequence:CCGGGCTGTCAGAATAACAGCCAATCTCGAGATTGGCTGTTATTCTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-939s1c1
Sequence:CCGGGAATGTCTGGAACATGGACTTCTCGAGAAGTCCATGTTCCAGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-848s1c1
Sequence:CCGGGAATGGCCTGTTTCCTCATTTCTCGAGAAATGAGGAAACAGGCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080655
VALIDATED
MSANTD3 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-627s1c1
Sequence:CCGGCCTCTCAGGAAGGTGCTTTAACTCGAGTTAAAGCACCTTCCTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-277s1c1
Sequence:CCGGGAAGAAGTGCTGGGAGAACATCTCGAGATGTTCTCCCAGCACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-323s1c1
Sequence:CCGGGCCCATGAAAGGAGAGAGAAACTCGAGTTTCTCTCTCCTTTCATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-656s1c1
Sequence:CCGGCATGAGGAAGAACACCATCAACTCGAGTTGATGGTGTTCTTCCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-930s1c1
Sequence:CCGGGTTGGCAAAGAATGTCTGGAACTCGAGTTCCAGACATTCTTTGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-479s1c1
Sequence:CCGGGCCCAAGAATCATTTGCTGTTCTCGAGAACAGCAAATGATTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-517s1c1
Sequence:CCGGCGATGATGAGAAAGAGTTCATCTCGAGATGAACTCTTTCTCATCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-1002s1c1
Sequence:CCGGGAGTGGTAGTAGTCACTTATTCTCGAGAATAAGTGACTACTACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-659s1c1
Sequence:CCGGGAGGAAGAACACCATCAACAACTCGAGTTGTTGATGGTGTTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-587s1c1
Sequence:CCGGGCTGTCAGAATAACAGCCAATCTCGAGATTGGCTGTTATTCTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-939s1c1
Sequence:CCGGGAATGTCTGGAACATGGACTTCTCGAGAAGTCCATGTTCCAGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-848s1c1
Sequence:CCGGGAATGGCCTGTTTCCTCATTTCTCGAGAAATGAGGAAACAGGCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080655
VALIDATED
MSANTD3 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-627s1c1
Sequence:CCGGCCTCTCAGGAAGGTGCTTTAACTCGAGTTAAAGCACCTTCCTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-277s1c1
Sequence:CCGGGAAGAAGTGCTGGGAGAACATCTCGAGATGTTCTCCCAGCACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-323s1c1
Sequence:CCGGGCCCATGAAAGGAGAGAGAAACTCGAGTTTCTCTCTCCTTTCATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-656s1c1
Sequence:CCGGCATGAGGAAGAACACCATCAACTCGAGTTGATGGTGTTCTTCCTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-930s1c1
Sequence:CCGGGTTGGCAAAGAATGTCTGGAACTCGAGTTCCAGACATTCTTTGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-479s1c1
Sequence:CCGGGCCCAAGAATCATTTGCTGTTCTCGAGAACAGCAAATGATTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-517s1c1
Sequence:CCGGCGATGATGAGAAAGAGTTCATCTCGAGATGAACTCTTTCTCATCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-1002s1c1
Sequence:CCGGGAGTGGTAGTAGTCACTTATTCTCGAGAATAAGTGACTACTACCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080655.1-659s1c1
Sequence:CCGGGAGGAAGAACACCATCAACAACTCGAGTTGTTGATGGTGTTCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_080655.1-587s1c1
Sequence:CCGGGCTGTCAGAATAACAGCCAATCTCGAGATTGGCTGTTATTCTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-939s1c1
Sequence:CCGGGAATGTCTGGAACATGGACTTCTCGAGAAGTCCATGTTCCAGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080655.1-848s1c1
Sequence:CCGGGAATGGCCTGTTTCCTCATTTCTCGAGAAATGAGGAAACAGGCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)