EMAIL THIS PAGE TO A FRIEND

MSANTD4

Myb/SANT-like DNA-binding domain containing 4 with coiled-coils

82 Gene Product Result for
Synonyms: KIAA1826
UniProtKB ID: Q8NCY6, Q96JK1, Q96JZ3, Q9H2N4
Gene ID:
Mouse(78100) Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Rat(500941) Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
chicken(418977) Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
cow(511226) Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
domestic cat(101098484) Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
domestic guinea pig(100729099) Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
naked mole-rat(101700817) Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032424 Rosetta Predictions human pricing
NM_001024357 Rosetta Predictions rat pricing
NM_145609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168861 predicted 2499
2 SASI_Hs01_00168862 predicted 2215
3 SASI_Hs01_00168863 predicted 2221
4 SASI_Hs01_00168864 predicted 2209
5 SASI_Hs01_00168866 predicted 2115
6 SASI_Hs01_00168867 predicted 2407
7 SASI_Hs01_00168868 predicted 2211
8 SASI_Hs01_00168869 predicted 1536
9 SASI_Hs02_00359828 predicted 1736
10 SASI_Hs02_00359829 predicted 2004
11 SASI_Hs01_00168860 predicted 2136
12 SASI_Hs01_00168865 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202586 predicted 1072
2 SASI_Rn01_00055249 predicted 854
3 SASI_Rn01_00055250 predicted 494
4 SASI_Rn01_00055251 predicted 1207
5 SASI_Rn01_00055252 predicted 1204
6 SASI_Rn01_00055253 predicted 1318
7 SASI_Rn01_00055254 predicted 351
8 SASI_Rn01_00055255 predicted 1150
9 SASI_Rn01_00055256 predicted 483
10 SASI_Rn01_00055257 predicted 460
11 SASI_Rn01_00055258 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189299 predicted 1469
2 SASI_Mm01_00189300 predicted 1397
3 SASI_Mm01_00189301 predicted 1209
4 SASI_Mm01_00189302 predicted 1251
5 SASI_Mm01_00189303 predicted 473
6 SASI_Mm01_00189304 predicted 1177
7 SASI_Mm01_00189305 predicted 310
8 SASI_Mm01_00189306 predicted 1171
9 SASI_Mm01_00189307 predicted 1488
10 SASI_Mm01_00189308 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032424
MSANTD4 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-1908s21c1
Sequence:CCGGGTCATCCGTCATACCAGATTCCTCGAGGAATCTGGTATGACGGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-1762s21c1
Sequence:CCGGGGATTCCGAAATGATGCAAATCTCGAGATTTGCATCATTTCGGAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032424.1-2595s21c1
Sequence:CCGGTGTATGCCTAAGTAGTATATACTCGAGTATATACTACTTAGGCATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-2015s21c1
Sequence:CCGGAGCCTCATTTGCTCGTAAATACTCGAGTATTTACGAGCAAATGAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1675s1c1
Sequence:CCGGGCCAACATTAAGCTGGTTGGTCTCGAGACCAACCAGCTTAATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1861s1c1
Sequence:CCGGGATCCGCAGAGTCCTGAATTTCTCGAGAAATTCAGGACTCTGCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032424.1-3694s1c1
Sequence:CCGGGCACGTATCTTTAGTCTCTTTCTCGAGAAAGAGACTAAAGATACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1979s1c1
Sequence:CCGGCCCTTAACTCAACACCATCTACTCGAGTAGATGGTGTTGAGTTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032424.1-1665s1c1
Sequence:CCGGGAGGATGAAGGCCAACATTAACTCGAGTTAATGTTGGCCTTCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1570s1c1
Sequence:CCGGGCACAGTGTGTGAATGCTGTACTCGAGTACAGCATTCACACACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032424
MSANTD4 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-1908s21c1
Sequence:CCGGGTCATCCGTCATACCAGATTCCTCGAGGAATCTGGTATGACGGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-1762s21c1
Sequence:CCGGGGATTCCGAAATGATGCAAATCTCGAGATTTGCATCATTTCGGAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032424.1-2595s21c1
Sequence:CCGGTGTATGCCTAAGTAGTATATACTCGAGTATATACTACTTAGGCATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-2015s21c1
Sequence:CCGGAGCCTCATTTGCTCGTAAATACTCGAGTATTTACGAGCAAATGAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1675s1c1
Sequence:CCGGGCCAACATTAAGCTGGTTGGTCTCGAGACCAACCAGCTTAATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1861s1c1
Sequence:CCGGGATCCGCAGAGTCCTGAATTTCTCGAGAAATTCAGGACTCTGCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032424.1-3694s1c1
Sequence:CCGGGCACGTATCTTTAGTCTCTTTCTCGAGAAAGAGACTAAAGATACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1979s1c1
Sequence:CCGGCCCTTAACTCAACACCATCTACTCGAGTAGATGGTGTTGAGTTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032424.1-1665s1c1
Sequence:CCGGGAGGATGAAGGCCAACATTAACTCGAGTTAATGTTGGCCTTCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1570s1c1
Sequence:CCGGGCACAGTGTGTGAATGCTGTACTCGAGTACAGCATTCACACACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032424
MSANTD4 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-1908s21c1
Sequence:CCGGGTCATCCGTCATACCAGATTCCTCGAGGAATCTGGTATGACGGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-1762s21c1
Sequence:CCGGGGATTCCGAAATGATGCAAATCTCGAGATTTGCATCATTTCGGAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032424.1-2595s21c1
Sequence:CCGGTGTATGCCTAAGTAGTATATACTCGAGTATATACTACTTAGGCATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032424.1-2015s21c1
Sequence:CCGGAGCCTCATTTGCTCGTAAATACTCGAGTATTTACGAGCAAATGAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1675s1c1
Sequence:CCGGGCCAACATTAAGCTGGTTGGTCTCGAGACCAACCAGCTTAATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1861s1c1
Sequence:CCGGGATCCGCAGAGTCCTGAATTTCTCGAGAAATTCAGGACTCTGCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032424.1-3694s1c1
Sequence:CCGGGCACGTATCTTTAGTCTCTTTCTCGAGAAAGAGACTAAAGATACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1979s1c1
Sequence:CCGGCCCTTAACTCAACACCATCTACTCGAGTAGATGGTGTTGAGTTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032424.1-1665s1c1
Sequence:CCGGGAGGATGAAGGCCAACATTAACTCGAGTTAATGTTGGCCTTCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032424.1-1570s1c1
Sequence:CCGGGCACAGTGTGTGAATGCTGTACTCGAGTACAGCATTCACACACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145609
MSANTD4 MISSION shRNA Bacterial Glycerol Stock
Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145609.1-1552s21c1
Sequence:CCGGGATGTTATTTGGTGGTCAAAGCTCGAGCTTTGACCACCAAATAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-230s21c1
Sequence:CCGGCCAAGAGGAAGGAAGTCATTTCTCGAGAAATGACTTCCTTCCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-504s21c1
Sequence:CCGGCTTCCGAAATGATGCAAATTTCTCGAGAAATTTGCATCATTTCGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-551s21c1
Sequence:CCGGGGGATGCAGGTGGATCCTTAACTCGAGTTAAGGATCCACCTGCATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-258s21c1
Sequence:CCGGGCAGCTCAACACAACAATAAACTCGAGTTTATTGTTGTGTTGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145609.1-1291s1c1
Sequence:CCGGCCCTGTTTAATGTCAGTGTTTCTCGAGAAACACTGACATTAAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-354s1c1
Sequence:CCGGCACAGAGGTTAAGAGACGTTACTCGAGTAACGTCTCTTAACCTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-353s1c1
Sequence:CCGGGCACAGAGGTTAAGAGACGTTCTCGAGAACGTCTCTTAACCTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-808s1c1
Sequence:CCGGCGACTTGATATTGAGGCGGAACTCGAGTTCCGCCTCAATATCAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145609
MSANTD4 MISSION shRNA shRNA Plasmid DNA
Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145609.1-1552s21c1
Sequence:CCGGGATGTTATTTGGTGGTCAAAGCTCGAGCTTTGACCACCAAATAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-230s21c1
Sequence:CCGGCCAAGAGGAAGGAAGTCATTTCTCGAGAAATGACTTCCTTCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-504s21c1
Sequence:CCGGCTTCCGAAATGATGCAAATTTCTCGAGAAATTTGCATCATTTCGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-551s21c1
Sequence:CCGGGGGATGCAGGTGGATCCTTAACTCGAGTTAAGGATCCACCTGCATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-258s21c1
Sequence:CCGGGCAGCTCAACACAACAATAAACTCGAGTTTATTGTTGTGTTGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145609.1-1291s1c1
Sequence:CCGGCCCTGTTTAATGTCAGTGTTTCTCGAGAAACACTGACATTAAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-354s1c1
Sequence:CCGGCACAGAGGTTAAGAGACGTTACTCGAGTAACGTCTCTTAACCTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-353s1c1
Sequence:CCGGGCACAGAGGTTAAGAGACGTTCTCGAGAACGTCTCTTAACCTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-808s1c1
Sequence:CCGGCGACTTGATATTGAGGCGGAACTCGAGTTCCGCCTCAATATCAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145609
MSANTD4 MISSION shRNA Lentiviral Transduction Particles
Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145609.1-1552s21c1
Sequence:CCGGGATGTTATTTGGTGGTCAAAGCTCGAGCTTTGACCACCAAATAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-230s21c1
Sequence:CCGGCCAAGAGGAAGGAAGTCATTTCTCGAGAAATGACTTCCTTCCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-504s21c1
Sequence:CCGGCTTCCGAAATGATGCAAATTTCTCGAGAAATTTGCATCATTTCGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-551s21c1
Sequence:CCGGGGGATGCAGGTGGATCCTTAACTCGAGTTAAGGATCCACCTGCATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145609.1-258s21c1
Sequence:CCGGGCAGCTCAACACAACAATAAACTCGAGTTTATTGTTGTGTTGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145609.1-1291s1c1
Sequence:CCGGCCCTGTTTAATGTCAGTGTTTCTCGAGAAACACTGACATTAAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-354s1c1
Sequence:CCGGCACAGAGGTTAAGAGACGTTACTCGAGTAACGTCTCTTAACCTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-353s1c1
Sequence:CCGGGCACAGAGGTTAAGAGACGTTCTCGAGAACGTCTCTTAACCTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145609.1-808s1c1
Sequence:CCGGCGACTTGATATTGAGGCGGAACTCGAGTTCCGCCTCAATATCAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)