EMAIL THIS PAGE TO A FRIEND

MSC

musculin

63 Gene Product Result for
Synonyms: ABF-1 ABF1 MYOR bHLHa22
UniProtKB ID: O60682, O75946, Q53XZ2, Q9BRE7
Gene ID:
Human(9242) Summary: The protein encoded by this gene is a transcriptional repressor capable of binding an E-box element either as a homodimer or as a heterodimer with E2A in vitro. The encoded protein also forms heterodimers with E2A proteins in vivo. This protein is capable of inhibiting the transactivation capability of E47, an E2A protein, in mammalian cells. This gene is a downstream target of the B-cell receptor signal transduction pathway. [provided by RefSeq, Jul 2008]
Mouse(17681) musculin
Rat(312897) musculin
fruit fly(249936) melanoscutellum
cow(507407) musculin
chicken(420179) musculin
dog(486992) musculin
sheep(101105828) musculin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005098 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005098 Rosetta Predictions human pricing
XM_001063707 Rosetta Predictions rat pricing
XM_232587 Rosetta Predictions rat pricing
NM_010827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188572 predicted 912
2 SASI_Hs01_00188573 predicted 946
3 SASI_Hs02_00338977 predicted 1327
4 SASI_Hs01_00188574 predicted 1135
5 SASI_Hs02_00338978 predicted 1375
6 SASI_Hs02_00338979 predicted 852
7 SASI_Hs01_00188575 predicted 1116
8 SASI_Hs01_00188576 predicted 1133
9 SASI_Hs01_00188571 predicted 1341
10 SASI_Hs01_00188577 predicted 955
11 SASI_Hs01_00188578 predicted 957
12 SASI_Hs01_00188579 predicted 839
13 SASI_Hs01_00188580 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308060 predicted 349
2 SASI_Rn02_00308061 predicted 347
3 SASI_Rn02_00308062 predicted 339
4 SASI_Rn02_00308063 predicted 286
5 SASI_Rn02_00308064 predicted 290
6 SASI_Rn02_00308065 predicted 244
7 SASI_Rn02_00308066 predicted 339
8 SASI_Rn02_00308067 predicted 337
9 SASI_Rn02_00308068 predicted 343
10 SASI_Rn02_00308069 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387170 predicted 352
2 SASI_Rn02_00387171 predicted 349
3 SASI_Rn02_00387172 predicted 341
4 SASI_Rn02_00387173 predicted 287
5 SASI_Rn02_00387174 predicted 285
6 SASI_Rn02_00387175 predicted 238
7 SASI_Rn02_00387176 predicted 331
8 SASI_Rn02_00387177 predicted 335
9 SASI_Rn02_00387178 predicted 334
10 SASI_Rn02_00387179 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126365 predicted 895
2 SASI_Mm01_00126366 predicted 336
3 SASI_Mm01_00126367 predicted 1262
4 SASI_Mm01_00126368 predicted 1027
5 SASI_Mm01_00126370 predicted 983
6 SASI_Mm02_00319448 predicted 808
7 SASI_Mm01_00126371 predicted 841
8 SASI_Mm01_00126369 predicted 1307
9 SASI_Mm01_00126372 predicted 798
10 SASI_Mm02_00319449 predicted 1193
11 SASI_Mm01_00126363 predicted 1059
12 SASI_Mm01_00126364 predicted 813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010827
MSC MISSION shRNA Bacterial Glycerol Stock
musculin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010827.1-999s1c1
Sequence:CCGGGTAACCAAAGAAAGCCCAGTTCTCGAGAACTGGGCTTTCTTTGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-803s1c1
Sequence:CCGGGCTTTGTGGAACTTCCGCTTACTCGAGTAAGCGGAAGTTCCACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-401s1c1
Sequence:CCGGCGCGGGAGGATGCAAGAGGAACTCGAGTTCCTCTTGCATCCTCCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-796s1c1
Sequence:CCGGCCAACAGGCTTTGTGGAACTTCTCGAGAAGTTCCACAAAGCCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-344s1c1
Sequence:CCGGCGACATTTCTTCTGCGGAAGACTCGAGTCTTCCGCAGAAGAAATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010827.2-728s21c1
Sequence:CCGGTGTGAACCTGACGTGGCCATTCTCGAGAATGGCCACGTCAGGTTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010827.2-1028s21c1
Sequence:CCGGAGAATACGTGGACCAGGTAAACTCGAGTTTACCTGGTCCACGTATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010827
MSC MISSION shRNA shRNA Plasmid DNA
musculin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010827.1-999s1c1
Sequence:CCGGGTAACCAAAGAAAGCCCAGTTCTCGAGAACTGGGCTTTCTTTGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-803s1c1
Sequence:CCGGGCTTTGTGGAACTTCCGCTTACTCGAGTAAGCGGAAGTTCCACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-401s1c1
Sequence:CCGGCGCGGGAGGATGCAAGAGGAACTCGAGTTCCTCTTGCATCCTCCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-796s1c1
Sequence:CCGGCCAACAGGCTTTGTGGAACTTCTCGAGAAGTTCCACAAAGCCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-344s1c1
Sequence:CCGGCGACATTTCTTCTGCGGAAGACTCGAGTCTTCCGCAGAAGAAATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010827.2-728s21c1
Sequence:CCGGTGTGAACCTGACGTGGCCATTCTCGAGAATGGCCACGTCAGGTTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010827.2-1028s21c1
Sequence:CCGGAGAATACGTGGACCAGGTAAACTCGAGTTTACCTGGTCCACGTATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010827
MSC MISSION shRNA Lentiviral Transduction Particles
musculin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010827.1-999s1c1
Sequence:CCGGGTAACCAAAGAAAGCCCAGTTCTCGAGAACTGGGCTTTCTTTGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-803s1c1
Sequence:CCGGGCTTTGTGGAACTTCCGCTTACTCGAGTAAGCGGAAGTTCCACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-401s1c1
Sequence:CCGGCGCGGGAGGATGCAAGAGGAACTCGAGTTCCTCTTGCATCCTCCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-796s1c1
Sequence:CCGGCCAACAGGCTTTGTGGAACTTCTCGAGAAGTTCCACAAAGCCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010827.1-344s1c1
Sequence:CCGGCGACATTTCTTCTGCGGAAGACTCGAGTCTTCCGCAGAAGAAATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010827.2-728s21c1
Sequence:CCGGTGTGAACCTGACGTGGCCATTCTCGAGAATGGCCACGTCAGGTTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010827.2-1028s21c1
Sequence:CCGGAGAATACGTGGACCAGGTAAACTCGAGTTTACCTGGTCCACGTATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005098
VALIDATED
MSC MISSION shRNA Bacterial Glycerol Stock
musculin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-1267s1c1
Sequence:CCGGGCGCTCTACATCCGCTTTAAACTCGAGTTTAAAGCGGATGTAGAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-842s1c1
Sequence:CCGGGAACTCACTTGATGGGATTATCTCGAGATAATCCCATCAAGTGAGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005098.2-659s1c1
Sequence:CCGGCCGGCTGGCTTCCAGTTACATCTCGAGATGTAACTGGAAGCCAGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005098.2-787s1c1
Sequence:CCGGCAAAGAAGTTTCCGCAGCCAACTCGAGTTGGCTGCGGAAACTTCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-824s1c1
Sequence:CCGGACCGCTTAAATCGGACTGGAACTCGAGTTCCAGTCCGATTTAAGCGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005098.3-879s21c1
Sequence:CCGGACCGGACTCTGACACCAAAGACTCGAGTCTTTGGTGTCAGAGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005098.3-844s21c1
Sequence:CCGGGTGAACCTGACATGGCCATTCCTCGAGGAATGGCCATGTCAGGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005098.3-920s21c1
Sequence:CCGGTATGTGGAACCACCGCTTAAACTCGAGTTTAAGCGGTGGTTCCACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005098.3-949s21c1
Sequence:CCGGGAACTCACTTGATGGGATTATCTCGAGATAATCCCATCAAGTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005098.3-1375s21c1
Sequence:CCGGGCGCTCTACATCCGCTTTAAACTCGAGTTTAAAGCGGATGTAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005098
VALIDATED
MSC MISSION shRNA shRNA Plasmid DNA
musculin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-1267s1c1
Sequence:CCGGGCGCTCTACATCCGCTTTAAACTCGAGTTTAAAGCGGATGTAGAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-842s1c1
Sequence:CCGGGAACTCACTTGATGGGATTATCTCGAGATAATCCCATCAAGTGAGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005098.2-659s1c1
Sequence:CCGGCCGGCTGGCTTCCAGTTACATCTCGAGATGTAACTGGAAGCCAGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005098.2-787s1c1
Sequence:CCGGCAAAGAAGTTTCCGCAGCCAACTCGAGTTGGCTGCGGAAACTTCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-824s1c1
Sequence:CCGGACCGCTTAAATCGGACTGGAACTCGAGTTCCAGTCCGATTTAAGCGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005098.3-879s21c1
Sequence:CCGGACCGGACTCTGACACCAAAGACTCGAGTCTTTGGTGTCAGAGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005098.3-844s21c1
Sequence:CCGGGTGAACCTGACATGGCCATTCCTCGAGGAATGGCCATGTCAGGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005098.3-920s21c1
Sequence:CCGGTATGTGGAACCACCGCTTAAACTCGAGTTTAAGCGGTGGTTCCACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005098.3-949s21c1
Sequence:CCGGGAACTCACTTGATGGGATTATCTCGAGATAATCCCATCAAGTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005098.3-1375s21c1
Sequence:CCGGGCGCTCTACATCCGCTTTAAACTCGAGTTTAAAGCGGATGTAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005098
VALIDATED
MSC MISSION shRNA Lentiviral Transduction Particles
musculin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-1267s1c1
Sequence:CCGGGCGCTCTACATCCGCTTTAAACTCGAGTTTAAAGCGGATGTAGAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-842s1c1
Sequence:CCGGGAACTCACTTGATGGGATTATCTCGAGATAATCCCATCAAGTGAGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005098.2-659s1c1
Sequence:CCGGCCGGCTGGCTTCCAGTTACATCTCGAGATGTAACTGGAAGCCAGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005098.2-787s1c1
Sequence:CCGGCAAAGAAGTTTCCGCAGCCAACTCGAGTTGGCTGCGGAAACTTCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005098.2-824s1c1
Sequence:CCGGACCGCTTAAATCGGACTGGAACTCGAGTTCCAGTCCGATTTAAGCGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005098.3-879s21c1
Sequence:CCGGACCGGACTCTGACACCAAAGACTCGAGTCTTTGGTGTCAGAGTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005098.3-844s21c1
Sequence:CCGGGTGAACCTGACATGGCCATTCCTCGAGGAATGGCCATGTCAGGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005098.3-920s21c1
Sequence:CCGGTATGTGGAACCACCGCTTAAACTCGAGTTTAAGCGGTGGTTCCACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005098.3-949s21c1
Sequence:CCGGGAACTCACTTGATGGGATTATCTCGAGATAATCCCATCAAGTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005098.3-1375s21c1
Sequence:CCGGGCGCTCTACATCCGCTTTAAACTCGAGTTTAAAGCGGATGTAGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)