EMAIL THIS PAGE TO A FRIEND

MSGN1

mesogenin 1

40 Gene Product Result for
Synonyms: MSOG
UniProtKB ID: A6NI15
Gene ID:
Mouse(56184) mesogenin 1
Rat(689864) mesogenin 1
sheep(101123540) mesogenin 1
Zebrafish(360135) mesogenin 1
dog(482981) mesogenin 1
chicken(395419) mesogenin 1
cow(521556) mesogenin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301947 ANTI-MSGN1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_292850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292850 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU027021 MISSION® esiRNA esiRNA targeting mouse Msgn1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105569 Rosetta Predictions human pricing
NM_001109551 Rosetta Predictions rat pricing
NM_019544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324491 predicted 267
2 SASI_Hs02_00324492 predicted 269
3 SASI_Hs02_00324493 predicted 331
4 SASI_Hs02_00324494 predicted 264
5 SASI_Hs02_00324495 predicted 344
6 SASI_Hs02_00324496 predicted 262
7 SASI_Hs02_00324497 predicted 340
8 SASI_Hs02_00324498 predicted 357
9 SASI_Hs02_00324499 predicted 257
10 SASI_Hs02_00324500 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249509 predicted 245
2 SASI_Rn02_00249510 predicted 382
3 SASI_Rn02_00249511 predicted 287
4 SASI_Rn02_00249512 predicted 337
5 SASI_Rn02_00249513 predicted 308
6 SASI_Rn02_00249514 predicted 408
7 SASI_Rn02_00249515 predicted 336
8 SASI_Rn02_00249516 predicted 322
9 SASI_Rn02_00249517 predicted 247
10 SASI_Rn02_00249518 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324587 predicted 324
2 SASI_Mm01_00181480 predicted 208
3 SASI_Mm01_00181481 predicted 258
4 SASI_Mm01_00181482 predicted 328
5 SASI_Mm01_00181483 predicted 294
6 SASI_Mm01_00181484 predicted 309
7 SASI_Mm01_00181485 predicted 316
8 SASI_Mm01_00181486 predicted 210
9 SASI_Mm01_00181487 predicted 325
10 SASI_Mm01_00181488 predicted 238
11 SASI_Mm01_00181489 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019544
MSGN1 MISSION shRNA Bacterial Glycerol Stock
mesogenin 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000108635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-245s1c1
Sequence:CCGGCCGGCTTAGTCGAGCTGGATTCTCGAGAATCCAGCTCGACTAAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-43s1c1
Sequence:CCGGCTGGACTCTTCTGACACCGCTCTCGAGAGCGGTGTCAGAAGAGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-393s1c1
Sequence:CCGGGCGGACCTTAGCCGATGCCCTCTCGAGAGGGCATCGGCTAAGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-286s1c1
Sequence:CCGGCCTCCCTATCTACACACTGCTCTCGAGAGCAGTGTGTAGATAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019544
MSGN1 MISSION shRNA shRNA Plasmid DNA
mesogenin 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000108635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-245s1c1
Sequence:CCGGCCGGCTTAGTCGAGCTGGATTCTCGAGAATCCAGCTCGACTAAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-43s1c1
Sequence:CCGGCTGGACTCTTCTGACACCGCTCTCGAGAGCGGTGTCAGAAGAGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-393s1c1
Sequence:CCGGGCGGACCTTAGCCGATGCCCTCTCGAGAGGGCATCGGCTAAGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-286s1c1
Sequence:CCGGCCTCCCTATCTACACACTGCTCTCGAGAGCAGTGTGTAGATAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019544
MSGN1 MISSION shRNA Lentiviral Transduction Particles
mesogenin 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000108635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-245s1c1
Sequence:CCGGCCGGCTTAGTCGAGCTGGATTCTCGAGAATCCAGCTCGACTAAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-43s1c1
Sequence:CCGGCTGGACTCTTCTGACACCGCTCTCGAGAGCGGTGTCAGAAGAGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-393s1c1
Sequence:CCGGGCGGACCTTAGCCGATGCCCTCTCGAGAGGGCATCGGCTAAGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019544.1-286s1c1
Sequence:CCGGCCTCCCTATCTACACACTGCTCTCGAGAGCAGTGTGTAGATAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292850
MSGN1 MISSION shRNA Bacterial Glycerol Stock
mesogenin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-274s1c1
Sequence:CCGGGAGGTGGACTACAATATGTTACTCGAGTAACATATTGTAGTCCACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-268s1c1
Sequence:CCGGCTGGTAGAGGTGGACTACAATCTCGAGATTGTAGTCCACCTCTACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-97s1c1
Sequence:CCGGGCAGGGCCCTTTGAGCTGAATCTCGAGATTCAGCTCAAAGGGCCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-152s1c1
Sequence:CCGGCATCGCTGGAATCCTATTCTTCTCGAGAAGAATAGGATTCCAGCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-390s1c1
Sequence:CCGGCGAGAGGGAGAAGCTCAGGATCTCGAGATCCTGAGCTTCTCCCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292850
MSGN1 MISSION shRNA shRNA Plasmid DNA
mesogenin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-274s1c1
Sequence:CCGGGAGGTGGACTACAATATGTTACTCGAGTAACATATTGTAGTCCACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-268s1c1
Sequence:CCGGCTGGTAGAGGTGGACTACAATCTCGAGATTGTAGTCCACCTCTACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-97s1c1
Sequence:CCGGGCAGGGCCCTTTGAGCTGAATCTCGAGATTCAGCTCAAAGGGCCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-152s1c1
Sequence:CCGGCATCGCTGGAATCCTATTCTTCTCGAGAAGAATAGGATTCCAGCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-390s1c1
Sequence:CCGGCGAGAGGGAGAAGCTCAGGATCTCGAGATCCTGAGCTTCTCCCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292850
MSGN1 MISSION shRNA Lentiviral Transduction Particles
mesogenin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-274s1c1
Sequence:CCGGGAGGTGGACTACAATATGTTACTCGAGTAACATATTGTAGTCCACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-268s1c1
Sequence:CCGGCTGGTAGAGGTGGACTACAATCTCGAGATTGTAGTCCACCTCTACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-97s1c1
Sequence:CCGGGCAGGGCCCTTTGAGCTGAATCTCGAGATTCAGCTCAAAGGGCCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-152s1c1
Sequence:CCGGCATCGCTGGAATCCTATTCTTCTCGAGAAGAATAGGATTCCAGCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292850.2-390s1c1
Sequence:CCGGCGAGAGGGAGAAGCTCAGGATCTCGAGATCCTGAGCTTCTCCCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)