EMAIL THIS PAGE TO A FRIEND

MSH2

mutS homolog 2

100 Gene Product Result for
Synonyms: COCA1 FCC1 HNPCC HNPCC1 LCFS2
UniProtKB ID: P43246, B4E2Z2, O75488
Gene ID:
Human(4436) Summary: This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(17685) mutS homolog 2 (E. coli)
Rat(81709) mutS homolog 2 (E. coli)
Zebrafish(406845) mutS homolog 2 (E. coli)
chicken(378799) mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
dog(494002) mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
domestic cat(101082051) mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
Thale Cress(821383) DNA mismatch repair protein Msh2
cow(533115) mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
naked mole-rat(101706924) mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
domestic guinea pig(100724489) mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
sheep(101107944) mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000251 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013561 MISSION® esiRNA esiRNA targeting human MSH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000251 siRNAs that have been validated in the lab human pricing
NM_031058 Rosetta Predictions rat pricing
NM_008628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000251 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000007 validated 2621
1 SASI_WI_00000008 validated 1610
1 SASI_WI_00000009 validated 2526
2 SASI_Hs01_00152463 predicted 1882
3 SASI_Hs01_00152464 predicted 1489
4 SASI_Hs02_00302172 predicted 1076
5 SASI_Hs01_00152465 predicted 2072
6 SASI_Hs01_00152466 predicted 2904
7 SASI_Hs01_00152467 predicted 2351
8 SASI_Hs02_00302173 predicted 950
9 SASI_Hs01_00152469 predicted 847
10 SASI_Hs01_00152470 predicted 1590
11 SASI_Hs01_00152471 predicted 2879
12 SASI_Hs01_00152468 predicted 1137
13 SASI_Hs01_00152472 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264294 predicted 2210
2 SASI_Rn01_00100786 predicted 1062
3 SASI_Rn01_00100787 predicted 2368
4 SASI_Rn01_00100788 predicted 625
5 SASI_Rn01_00100789 predicted 2495
6 SASI_Rn01_00100790 predicted 1070
7 SASI_Rn01_00100791 predicted 2292
8 SASI_Rn01_00100794 predicted 2461
9 SASI_Rn01_00100795 predicted 861
10 SASI_Rn02_00264295 predicted 2763
11 SASI_Rn01_00100792 predicted 212
12 SASI_Rn01_00100793 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157037 predicted 2304
2 SASI_Mm01_00157038 predicted 2245
3 SASI_Mm01_00157039 predicted 2323
4 SASI_Mm01_00157040 predicted 1108
5 SASI_Mm01_00157041 predicted 1847
6 SASI_Mm01_00157042 predicted 2715
7 SASI_Mm01_00157043 predicted 1100
8 SASI_Mm01_00157044 predicted 2495
9 SASI_Mm01_00157045 predicted 373
10 SASI_Mm02_00314332 predicted 2407
11 SASI_Mm01_00157046 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008628
VALIDATED
MSH2 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008628.1-412s1c1
Sequence:CCGGCCCGGCAATCTTTCTCAGTTTCTCGAGAAACTGAGAAAGATTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-2811s21c1
Sequence:CCGGCGAGATCATTTCACGGATAAACTCGAGTTTATCCGTGAAATGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008628.2-2881s21c1
Sequence:CCGGACCTTTACTGTGTGCTGTTCTCTCGAGAGAACAGCACACAGTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-1254s21c1
Sequence:CCGGCCGACTGTATCAGGGTATTAACTCGAGTTAATACCCTGATACAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008628.1-2350s1c1
Sequence:CCGGGCAACGAAGATTGGTGCCTTTCTCGAGAAAGGCACCAATCTTCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008628.1-1254s1c1
Sequence:CCGGCCGACTGTATCAGGGTATTAACTCGAGTTAATACCCTGATACAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008628.1-1837s1c1
Sequence:CCGGGCTCACTTAGACGCCATTGTTCTCGAGAACAATGGCGTCTAAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-412s21c1
Sequence:CCGGCCCGGCAATCTTTCTCAGTTTCTCGAGAAACTGAGAAAGATTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-472s21c1
Sequence:CCGGGTTGGCGTTATGGGTATTAAACTCGAGTTTAATACCCATAACGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008628
VALIDATED
MSH2 MISSION shRNA shRNA Plasmid DNA
mutS homolog 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008628.1-412s1c1
Sequence:CCGGCCCGGCAATCTTTCTCAGTTTCTCGAGAAACTGAGAAAGATTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-2811s21c1
Sequence:CCGGCGAGATCATTTCACGGATAAACTCGAGTTTATCCGTGAAATGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008628.2-2881s21c1
Sequence:CCGGACCTTTACTGTGTGCTGTTCTCTCGAGAGAACAGCACACAGTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-1254s21c1
Sequence:CCGGCCGACTGTATCAGGGTATTAACTCGAGTTAATACCCTGATACAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008628.1-2350s1c1
Sequence:CCGGGCAACGAAGATTGGTGCCTTTCTCGAGAAAGGCACCAATCTTCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008628.1-1254s1c1
Sequence:CCGGCCGACTGTATCAGGGTATTAACTCGAGTTAATACCCTGATACAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008628.1-1837s1c1
Sequence:CCGGGCTCACTTAGACGCCATTGTTCTCGAGAACAATGGCGTCTAAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-412s21c1
Sequence:CCGGCCCGGCAATCTTTCTCAGTTTCTCGAGAAACTGAGAAAGATTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-472s21c1
Sequence:CCGGGTTGGCGTTATGGGTATTAAACTCGAGTTTAATACCCATAACGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008628
VALIDATED
MSH2 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008628.1-412s1c1
Sequence:CCGGCCCGGCAATCTTTCTCAGTTTCTCGAGAAACTGAGAAAGATTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-2811s21c1
Sequence:CCGGCGAGATCATTTCACGGATAAACTCGAGTTTATCCGTGAAATGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008628.2-2881s21c1
Sequence:CCGGACCTTTACTGTGTGCTGTTCTCTCGAGAGAACAGCACACAGTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-1254s21c1
Sequence:CCGGCCGACTGTATCAGGGTATTAACTCGAGTTAATACCCTGATACAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008628.1-2350s1c1
Sequence:CCGGGCAACGAAGATTGGTGCCTTTCTCGAGAAAGGCACCAATCTTCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008628.1-1254s1c1
Sequence:CCGGCCGACTGTATCAGGGTATTAACTCGAGTTAATACCCTGATACAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008628.1-1837s1c1
Sequence:CCGGGCTCACTTAGACGCCATTGTTCTCGAGAACAATGGCGTCTAAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-412s21c1
Sequence:CCGGCCCGGCAATCTTTCTCAGTTTCTCGAGAAACTGAGAAAGATTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008628.2-472s21c1
Sequence:CCGGGTTGGCGTTATGGGTATTAAACTCGAGTTTAATACCCATAACGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000251
VALIDATED
MSH2 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.x-429s1c1
Sequence:CCGGTATAAGGCTTCTCCTGGCAATCTCGAGATTGCCAGGAGAAGCCTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.1-2880s1c1
Sequence:CCGGCCAGTAATGGAATGAAGGTAACTCGAGTTACCTTCATTCCATTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-2550s21c1
Sequence:CCGGATTCATGTTGCAGAGCTTGCTCTCGAGAGCAAGCTCTGCAACATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-441s21c1
Sequence:CCGGCCTGGCAATCTCTCTCAGTTTCTCGAGAAACTGAGAGAGATTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.x-2550s1c1
Sequence:CCGGATTCATGTTGCAGAGCTTGCTCTCGAGAGCAAGCTCTGCAACATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000251.1-2582s1c1
Sequence:CCGGGCATGTAATAGAGTGTGCTAACTCGAGTTAGCACACTCTATTACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000251.1-958s1c1
Sequence:CCGGGCCAGTATATGAAATTGGATACTCGAGTATCCAATTTCATATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.1-1050s1c1
Sequence:CCGGGCCTTGCTGAATAAGTGTAAACTCGAGTTTACACTTATTCAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000251.1-3079s21c1
Sequence:CCGGTTGCAATTGACATAGGCAATACTCGAGTATTGCCTATGTCAATTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-1050s21c1
Sequence:CCGGGCCTTGCTGAATAAGTGTAAACTCGAGTTTACACTTATTCAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000251
VALIDATED
MSH2 MISSION shRNA shRNA Plasmid DNA
mutS homolog 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.x-429s1c1
Sequence:CCGGTATAAGGCTTCTCCTGGCAATCTCGAGATTGCCAGGAGAAGCCTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.1-2880s1c1
Sequence:CCGGCCAGTAATGGAATGAAGGTAACTCGAGTTACCTTCATTCCATTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-2550s21c1
Sequence:CCGGATTCATGTTGCAGAGCTTGCTCTCGAGAGCAAGCTCTGCAACATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-441s21c1
Sequence:CCGGCCTGGCAATCTCTCTCAGTTTCTCGAGAAACTGAGAGAGATTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.x-2550s1c1
Sequence:CCGGATTCATGTTGCAGAGCTTGCTCTCGAGAGCAAGCTCTGCAACATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000251.1-2582s1c1
Sequence:CCGGGCATGTAATAGAGTGTGCTAACTCGAGTTAGCACACTCTATTACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000251.1-958s1c1
Sequence:CCGGGCCAGTATATGAAATTGGATACTCGAGTATCCAATTTCATATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.1-1050s1c1
Sequence:CCGGGCCTTGCTGAATAAGTGTAAACTCGAGTTTACACTTATTCAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000251.1-3079s21c1
Sequence:CCGGTTGCAATTGACATAGGCAATACTCGAGTATTGCCTATGTCAATTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-1050s21c1
Sequence:CCGGGCCTTGCTGAATAAGTGTAAACTCGAGTTTACACTTATTCAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000251
VALIDATED
MSH2 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.x-429s1c1
Sequence:CCGGTATAAGGCTTCTCCTGGCAATCTCGAGATTGCCAGGAGAAGCCTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.1-2880s1c1
Sequence:CCGGCCAGTAATGGAATGAAGGTAACTCGAGTTACCTTCATTCCATTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-2550s21c1
Sequence:CCGGATTCATGTTGCAGAGCTTGCTCTCGAGAGCAAGCTCTGCAACATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-441s21c1
Sequence:CCGGCCTGGCAATCTCTCTCAGTTTCTCGAGAAACTGAGAGAGATTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.x-2550s1c1
Sequence:CCGGATTCATGTTGCAGAGCTTGCTCTCGAGAGCAAGCTCTGCAACATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000251.1-2582s1c1
Sequence:CCGGGCATGTAATAGAGTGTGCTAACTCGAGTTAGCACACTCTATTACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000251.1-958s1c1
Sequence:CCGGGCCAGTATATGAAATTGGATACTCGAGTATCCAATTTCATATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000251.1-1050s1c1
Sequence:CCGGGCCTTGCTGAATAAGTGTAAACTCGAGTTTACACTTATTCAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000251.1-3079s21c1
Sequence:CCGGTTGCAATTGACATAGGCAATACTCGAGTATTGCCTATGTCAATTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000251.1-1050s21c1
Sequence:CCGGGCCTTGCTGAATAAGTGTAAACTCGAGTTTACACTTATTCAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)