EMAIL THIS PAGE TO A FRIEND

MSH4

mutS homolog 4 (E. coli)

51 Gene Product Result for
UniProtKB ID: O15457, Q5T4U6, Q8NEB3, Q9UNP8
Gene ID:
Human(4438) Summary: This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
Mouse(55993) mutS homolog 4 (E. coli)
Rat(295541) mutS homolog 4 (E. coli)
Zebrafish(559917) mutS homolog 4 (E. coli)
cow(616664) mutS homolog 4 (E. coli)
Horse(100053320) mutS homolog 4 (E. coli)
domestic cat(101090537) mutS homolog 4 (E. coli)
dog(612681) mutS homolog 4 (E. coli)
chicken(424725) mutS homolog 4 (E. coli)
Thale Cress(827450) DNA mismatch repair protein MSH4
Domestic Rabbit(100345599) mutS homolog 4 (E. coli)
naked mole-rat(101709577) mutS homolog 4 (E. coli)
domestic guinea pig(100715278) mutS homolog 4 (E. coli)
sheep(101120967) mutS homolog 4 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104683 Anti-MSH4, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021961 MISSION® esiRNA esiRNA human MSH4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002440 Rosetta Predictions human pricing
NM_001106477 Rosetta Predictions rat pricing
NM_031870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053825 predicted 2107
2 SASI_Hs01_00053826 predicted 2037
3 SASI_Hs01_00053827 predicted 1360
4 SASI_Hs01_00053828 predicted 1474
5 SASI_Hs01_00053829 predicted 1270
6 SASI_Hs01_00053830 predicted 2424
7 SASI_Hs01_00053831 predicted 1377
8 SASI_Hs01_00053832 predicted 1650
9 SASI_Hs01_00053833 predicted 1890
10 SASI_Hs01_00053834 predicted 2316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219348 predicted 1451
2 SASI_Rn02_00219349 predicted 2178
3 SASI_Rn02_00219350 predicted 900
4 SASI_Rn02_00219351 predicted 1822
5 SASI_Rn02_00219352 predicted 796
6 SASI_Rn02_00219353 predicted 1626
7 SASI_Rn02_00219354 predicted 1284
8 SASI_Rn02_00219355 predicted 1153
9 SASI_Rn02_00219356 predicted 615
10 SASI_Rn02_00219357 predicted 1899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150295 predicted 1193
2 SASI_Mm01_00150297 predicted 1586
3 SASI_Mm01_00150298 predicted 2280
4 SASI_Mm01_00150299 predicted 1746
5 SASI_Mm01_00150300 predicted 1096
6 SASI_Mm01_00150301 predicted 1923
7 SASI_Mm01_00150302 predicted 2520
8 SASI_Mm01_00150303 predicted 909
9 SASI_Mm01_00150304 predicted 2598
10 SASI_Mm02_00337184 predicted 2255
11 SASI_Mm01_00150296 predicted 1568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002440
MSH4 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 4 (E. coli)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-2289s1c1
Sequence:CCGGGCTAATGACAAATCGCTCATACTCGAGTATGAGCGATTTGTCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002440.2-842s21c1
Sequence:CCGGGGAGGTTCAGTCCAAGTATTACTCGAGTAATACTTGGACTGAACCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1578s1c1
Sequence:CCGGGCAGGAATGATATCACAACTTCTCGAGAAGTTGTGATATCATTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002440.2-1106s21c1
Sequence:CCGGATTAGAGCCTCTAGTTGATATCTCGAGATATCAACTAGAGGCTCTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1783s1c1
Sequence:CCGGGCCAAGAATCTTTGAGAGAAACTCGAGTTTCTCTCAAAGATTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-501s1c1
Sequence:CCGGCCATCAGTTATTGTAGCTGTTCTCGAGAACAGCTACAATAACTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-361s1c1
Sequence:CCGGCTTCTGCACGAGATACTAATTCTCGAGAATTAGTATCTCGTGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1658s1c1
Sequence:CCGGCCAGATGACTACAGATTGTATCTCGAGATACAATCTGTAGTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-544s1c1
Sequence:CCGGGAGGTGAAATAGGAATGGCAACTCGAGTTGCCATTCCTATTTCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002440
MSH4 MISSION shRNA shRNA Plasmid DNA
mutS homolog 4 (E. coli)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-2289s1c1
Sequence:CCGGGCTAATGACAAATCGCTCATACTCGAGTATGAGCGATTTGTCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002440.2-842s21c1
Sequence:CCGGGGAGGTTCAGTCCAAGTATTACTCGAGTAATACTTGGACTGAACCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1578s1c1
Sequence:CCGGGCAGGAATGATATCACAACTTCTCGAGAAGTTGTGATATCATTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002440.2-1106s21c1
Sequence:CCGGATTAGAGCCTCTAGTTGATATCTCGAGATATCAACTAGAGGCTCTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1783s1c1
Sequence:CCGGGCCAAGAATCTTTGAGAGAAACTCGAGTTTCTCTCAAAGATTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-501s1c1
Sequence:CCGGCCATCAGTTATTGTAGCTGTTCTCGAGAACAGCTACAATAACTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-361s1c1
Sequence:CCGGCTTCTGCACGAGATACTAATTCTCGAGAATTAGTATCTCGTGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1658s1c1
Sequence:CCGGCCAGATGACTACAGATTGTATCTCGAGATACAATCTGTAGTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-544s1c1
Sequence:CCGGGAGGTGAAATAGGAATGGCAACTCGAGTTGCCATTCCTATTTCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002440
MSH4 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 4 (E. coli)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-2289s1c1
Sequence:CCGGGCTAATGACAAATCGCTCATACTCGAGTATGAGCGATTTGTCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002440.2-842s21c1
Sequence:CCGGGGAGGTTCAGTCCAAGTATTACTCGAGTAATACTTGGACTGAACCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1578s1c1
Sequence:CCGGGCAGGAATGATATCACAACTTCTCGAGAAGTTGTGATATCATTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002440.2-1106s21c1
Sequence:CCGGATTAGAGCCTCTAGTTGATATCTCGAGATATCAACTAGAGGCTCTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1783s1c1
Sequence:CCGGGCCAAGAATCTTTGAGAGAAACTCGAGTTTCTCTCAAAGATTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-501s1c1
Sequence:CCGGCCATCAGTTATTGTAGCTGTTCTCGAGAACAGCTACAATAACTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-361s1c1
Sequence:CCGGCTTCTGCACGAGATACTAATTCTCGAGAATTAGTATCTCGTGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-1658s1c1
Sequence:CCGGCCAGATGACTACAGATTGTATCTCGAGATACAATCTGTAGTCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002440.2-544s1c1
Sequence:CCGGGAGGTGAAATAGGAATGGCAACTCGAGTTGCCATTCCTATTTCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031870
MSH4 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 4 (E. coli)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-1963s21c1
Sequence:CCGGCCAAGAGTCTTTGCGAGAAATCTCGAGATTTCTCGCAAAGACTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031870.1-3057s1c1
Sequence:CCGGGCAACTTAGTTGCTCAGCTTTCTCGAGAAAGCTGAGCAACTAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-1583s21c1
Sequence:CCGGGACCATAGGTTTGGGCTAATACTCGAGTATTAGCCCAAACCTATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-2208s21c1
Sequence:CCGGTCGCCAACAATACCTACATTACTCGAGTAATGTAGGTATTGTTGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031870.1-1103s1c1
Sequence:CCGGGCACCCAAATCGCTAAAGATTCTCGAGAATCTTTAGCGATTTGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031870.1-2207s1c1
Sequence:CCGGGTCGCCAACAATACCTACATTCTCGAGAATGTAGGTATTGTTGGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031870.2-3110s21c1
Sequence:CCGGTCAGAATGGTCACCTACTATGCTCGAGCATAGTAGGTGACCATTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-2271s21c1
Sequence:CCGGGCGGAAAGTCCACGTACTTAACTCGAGTTAAGTACGTGGACTTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031870
MSH4 MISSION shRNA shRNA Plasmid DNA
mutS homolog 4 (E. coli)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-1963s21c1
Sequence:CCGGCCAAGAGTCTTTGCGAGAAATCTCGAGATTTCTCGCAAAGACTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031870.1-3057s1c1
Sequence:CCGGGCAACTTAGTTGCTCAGCTTTCTCGAGAAAGCTGAGCAACTAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-1583s21c1
Sequence:CCGGGACCATAGGTTTGGGCTAATACTCGAGTATTAGCCCAAACCTATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-2208s21c1
Sequence:CCGGTCGCCAACAATACCTACATTACTCGAGTAATGTAGGTATTGTTGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031870.1-1103s1c1
Sequence:CCGGGCACCCAAATCGCTAAAGATTCTCGAGAATCTTTAGCGATTTGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031870.1-2207s1c1
Sequence:CCGGGTCGCCAACAATACCTACATTCTCGAGAATGTAGGTATTGTTGGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031870.2-3110s21c1
Sequence:CCGGTCAGAATGGTCACCTACTATGCTCGAGCATAGTAGGTGACCATTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-2271s21c1
Sequence:CCGGGCGGAAAGTCCACGTACTTAACTCGAGTTAAGTACGTGGACTTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031870
MSH4 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 4 (E. coli)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-1963s21c1
Sequence:CCGGCCAAGAGTCTTTGCGAGAAATCTCGAGATTTCTCGCAAAGACTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031870.1-3057s1c1
Sequence:CCGGGCAACTTAGTTGCTCAGCTTTCTCGAGAAAGCTGAGCAACTAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-1583s21c1
Sequence:CCGGGACCATAGGTTTGGGCTAATACTCGAGTATTAGCCCAAACCTATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-2208s21c1
Sequence:CCGGTCGCCAACAATACCTACATTACTCGAGTAATGTAGGTATTGTTGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031870.1-1103s1c1
Sequence:CCGGGCACCCAAATCGCTAAAGATTCTCGAGAATCTTTAGCGATTTGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031870.1-2207s1c1
Sequence:CCGGGTCGCCAACAATACCTACATTCTCGAGAATGTAGGTATTGTTGGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031870.2-3110s21c1
Sequence:CCGGTCAGAATGGTCACCTACTATGCTCGAGCATAGTAGGTGACCATTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031870.2-2271s21c1
Sequence:CCGGGCGGAAAGTCCACGTACTTAACTCGAGTTAAGTACGTGGACTTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)