EMAIL THIS PAGE TO A FRIEND

MSH5

mutS homolog 5

201 Gene Product Result for
Synonyms: G7 MUTSH5 NG23
Gene ID:
Human(4439) Summary: This gene encodes a member of the mutS family of proteins that are involved in DNA mismatch repair and meiotic recombination. This protein is similar to a Saccharomyces cerevisiae protein that participates in segregation fidelity and crossing-over events during meiosis. This protein plays a role in promoting ionizing radiation-induced apoptosis. This protein forms hetero-oligomers with another member of this family, mutS homolog 4. Polymorphisms in this gene have been linked to various human diseases, including IgA deficiency, common variable immunodeficiency, and premature ovarian failure. Alternative splicing results multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 6 open reading frame 26 (C6orf26) gene. [provided by RefSeq, Feb 2011]
Mouse(17687) mutS homolog 5 (E. coli)
Rat(294252) mutS homolog 5 (E. coli)
sheep(101117884) mutS homolog 5 (E. coli)
domestic guinea pig(100730559) mutS homolog 5 (E. coli)
naked mole-rat(101702743) mutS homolog 5 (E. coli)
Domestic Rabbit(100352507) mutS homolog 5 (E. coli)
Zebrafish(570030) mutS homolog 5 (E. coli)
cow(100139295) mutS homolog 5 (E. coli)
Horse(100050672) mutS homolog 5 (E. coli)
domestic cat(101090014) mutS homolog 5 (E. coli)
dog(474848) mutS homolog 5 (E. coli)
Thale Cress(821593) DNA mismatch repair protein MSH5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002441 Rosetta Predictions human pricing
NM_025259 Rosetta Predictions human pricing
NM_172165 Rosetta Predictions human pricing
NM_172166 Rosetta Predictions human pricing
NM_212536 Rosetta Predictions rat pricing
NM_013600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204447 predicted 2582
2 SASI_Hs01_00204448 predicted 1503
3 SASI_Hs01_00204451 predicted 1784
4 SASI_Hs01_00204452 predicted 1430
5 SASI_Hs02_00333843 predicted 2585
6 SASI_Hs01_00204453 predicted 1918
7 SASI_Hs01_00204454 predicted 1048
8 SASI_Hs01_00204455 predicted 1181
9 SASI_Hs01_00204456 predicted 2442
10 SASI_Hs02_00333844 predicted 1658
11 SASI_Hs01_00204449 predicted 2592
12 SASI_Hs01_00204450 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194803 predicted 2476
2 SASI_Hs01_00194804 predicted 1402
3 SASI_Hs01_00194807 predicted 1671
4 SASI_Hs01_00194808 predicted 1321
5 SASI_Hs02_00358102 predicted 2476
6 SASI_Hs01_00194809 predicted 1812
7 SASI_Hs01_00194810 predicted 942
8 SASI_Hs01_00194811 predicted 1079
9 SASI_Hs01_00194812 predicted 2337
10 SASI_Hs02_00358103 predicted 1558
11 SASI_Hs01_00194805 predicted 2490
12 SASI_Hs01_00194806 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014705 predicted 2423
2 SASI_Hs01_00014706 predicted 1351
3 SASI_Hs01_00014709 predicted 1628
4 SASI_Hs01_00014710 predicted 1268
5 SASI_Hs02_00367862 predicted 2424
6 SASI_Hs01_00014711 predicted 1756
7 SASI_Hs01_00014712 predicted 893
8 SASI_Hs01_00014713 predicted 1019
9 SASI_Hs01_00014714 predicted 2288
10 SASI_Hs02_00367863 predicted 1503
11 SASI_Hs01_00014707 predicted 2436
12 SASI_Hs01_00014708 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050024 predicted 2425
2 SASI_Hs01_00050025 predicted 1349
3 SASI_Hs01_00050028 predicted 1625
4 SASI_Hs01_00050029 predicted 1270
5 SASI_Hs02_00367864 predicted 2418
6 SASI_Hs01_00050030 predicted 1755
7 SASI_Hs01_00050031 predicted 894
8 SASI_Hs01_00050032 predicted 1025
9 SASI_Hs01_00050033 predicted 2278
10 SASI_Hs02_00367865 predicted 1503
11 SASI_Hs01_00050026 predicted 2434
12 SASI_Hs01_00050027 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056181 predicted 2015
2 SASI_Rn02_00270557 predicted 661
3 SASI_Rn01_00056183 predicted 398
4 SASI_Rn01_00056184 predicted 1077
5 SASI_Rn01_00056185 predicted 853
6 SASI_Rn01_00056186 predicted 1854
7 SASI_Rn01_00056187 predicted 854
8 SASI_Rn02_00270558 predicted 1548
9 SASI_Rn01_00056188 predicted 597
10 SASI_Rn01_00056189 predicted 1305
11 SASI_Rn01_00056182 predicted 859
12 SASI_Rn01_00056190 predicted 2530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086199 predicted 2038
2 SASI_Mm01_00086200 predicted 1872
3 SASI_Mm01_00086201 predicted 1385
4 SASI_Mm01_00086202 predicted 2179
5 SASI_Mm01_00086203 predicted 2117
6 SASI_Mm01_00086204 predicted 2547
7 SASI_Mm01_00086205 predicted 870
8 SASI_Mm01_00086206 predicted 1896
9 SASI_Mm01_00086207 predicted 453
10 SASI_Mm01_00086208 predicted 2141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025259
VALIDATED
MSH5 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-2120s21c1
Sequence:CCGGGCACAGTCGCTGGTCCTTATTCTCGAGAATAAGGACCAGCGACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-1678s21c1
Sequence:CCGGAGCTGTCTTAACCCGAGTATTCTCGAGAATACTCGGGTTAAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-2529s21c1
Sequence:CCGGAGACATTAGTGGATAAGTTTACTCGAGTAAACTTATCCACTAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-1913s21c1
Sequence:CCGGTCATCAGGGAAGAGCATATACCTCGAGGTATATGCTCTTCCCTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-719s21c1
Sequence:CCGGGTTGAACTGGAAGACTATAATCTCGAGATTATAGTCTTCCAGTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_025259.x-255s1c1
Sequence:CCGGATACTAGTGACTCCACTATCCTCGAGGATAGTGGAGTCACTAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.x-2892s1c1
Sequence:CCGGCAGGATACTTCATGAGAACGACTCGAGTCGTTCTCATGAAGTATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.x-3776s1c1
Sequence:CCGGCAATGAAGTTCAGACATGTTGCTCGAGCAACATGTCTGAACTTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.3-3544s1c1
Sequence:CCGGCCACCCAGGATTCAAAGGAAACTCGAGTTTCCTTTGAATCCTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-2524s1c1
Sequence:CCGGCCAGACATTAGTGGATAAGTTCTCGAGAACTTATCCACTAATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-2012s1c1
Sequence:CCGGGACGCCATCTTCACACGAATTCTCGAGAATTCGTGTGAAGATGGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-577s1c1
Sequence:CCGGCCTCTCTTCCATTATTCCCTTCTCGAGAAGGGAATAATGGAAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-1316s1c1
Sequence:CCGGCCCAACATAGATCCTGAAATTCTCGAGAATTTCAGGATCTATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025259
VALIDATED
MSH5 MISSION shRNA shRNA Plasmid DNA
mutS homolog 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-2120s21c1
Sequence:CCGGGCACAGTCGCTGGTCCTTATTCTCGAGAATAAGGACCAGCGACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-1678s21c1
Sequence:CCGGAGCTGTCTTAACCCGAGTATTCTCGAGAATACTCGGGTTAAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-2529s21c1
Sequence:CCGGAGACATTAGTGGATAAGTTTACTCGAGTAAACTTATCCACTAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-1913s21c1
Sequence:CCGGTCATCAGGGAAGAGCATATACCTCGAGGTATATGCTCTTCCCTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-719s21c1
Sequence:CCGGGTTGAACTGGAAGACTATAATCTCGAGATTATAGTCTTCCAGTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_025259.x-255s1c1
Sequence:CCGGATACTAGTGACTCCACTATCCTCGAGGATAGTGGAGTCACTAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.x-2892s1c1
Sequence:CCGGCAGGATACTTCATGAGAACGACTCGAGTCGTTCTCATGAAGTATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.x-3776s1c1
Sequence:CCGGCAATGAAGTTCAGACATGTTGCTCGAGCAACATGTCTGAACTTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.3-3544s1c1
Sequence:CCGGCCACCCAGGATTCAAAGGAAACTCGAGTTTCCTTTGAATCCTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-2524s1c1
Sequence:CCGGCCAGACATTAGTGGATAAGTTCTCGAGAACTTATCCACTAATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-2012s1c1
Sequence:CCGGGACGCCATCTTCACACGAATTCTCGAGAATTCGTGTGAAGATGGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-577s1c1
Sequence:CCGGCCTCTCTTCCATTATTCCCTTCTCGAGAAGGGAATAATGGAAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-1316s1c1
Sequence:CCGGCCCAACATAGATCCTGAAATTCTCGAGAATTTCAGGATCTATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025259
VALIDATED
MSH5 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-2120s21c1
Sequence:CCGGGCACAGTCGCTGGTCCTTATTCTCGAGAATAAGGACCAGCGACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-1678s21c1
Sequence:CCGGAGCTGTCTTAACCCGAGTATTCTCGAGAATACTCGGGTTAAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-2529s21c1
Sequence:CCGGAGACATTAGTGGATAAGTTTACTCGAGTAAACTTATCCACTAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-1913s21c1
Sequence:CCGGTCATCAGGGAAGAGCATATACCTCGAGGTATATGCTCTTCCCTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025259.4-719s21c1
Sequence:CCGGGTTGAACTGGAAGACTATAATCTCGAGATTATAGTCTTCCAGTTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_025259.x-255s1c1
Sequence:CCGGATACTAGTGACTCCACTATCCTCGAGGATAGTGGAGTCACTAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.x-2892s1c1
Sequence:CCGGCAGGATACTTCATGAGAACGACTCGAGTCGTTCTCATGAAGTATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.x-3776s1c1
Sequence:CCGGCAATGAAGTTCAGACATGTTGCTCGAGCAACATGTCTGAACTTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025259.3-3544s1c1
Sequence:CCGGCCACCCAGGATTCAAAGGAAACTCGAGTTTCCTTTGAATCCTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-2524s1c1
Sequence:CCGGCCAGACATTAGTGGATAAGTTCTCGAGAACTTATCCACTAATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-2012s1c1
Sequence:CCGGGACGCCATCTTCACACGAATTCTCGAGAATTCGTGTGAAGATGGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-577s1c1
Sequence:CCGGCCTCTCTTCCATTATTCCCTTCTCGAGAAGGGAATAATGGAAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025259.3-1316s1c1
Sequence:CCGGCCCAACATAGATCCTGAAATTCTCGAGAATTTCAGGATCTATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013600
MSH5 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-1434s1c1
Sequence:CCGGCCTAACATAGACCCTGACATACTCGAGTATGTCAGGGTCTATGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-915s1c1
Sequence:CCGGCAAGACACTTACAGCGTTCTACTCGAGTAGAACGCTGTAAGTGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-2605s1c1
Sequence:CCGGCGAATGAGCTTCTAAGGAGAACTCGAGTTCTCCTTAGAAGCTCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-509s1c1
Sequence:CCGGCCAGAGAGTTCTGGATGAAATCTCGAGATTTCATCCAGAACTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013600
MSH5 MISSION shRNA shRNA Plasmid DNA
mutS homolog 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-1434s1c1
Sequence:CCGGCCTAACATAGACCCTGACATACTCGAGTATGTCAGGGTCTATGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-915s1c1
Sequence:CCGGCAAGACACTTACAGCGTTCTACTCGAGTAGAACGCTGTAAGTGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-2605s1c1
Sequence:CCGGCGAATGAGCTTCTAAGGAGAACTCGAGTTCTCCTTAGAAGCTCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-509s1c1
Sequence:CCGGCCAGAGAGTTCTGGATGAAATCTCGAGATTTCATCCAGAACTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013600
MSH5 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-1434s1c1
Sequence:CCGGCCTAACATAGACCCTGACATACTCGAGTATGTCAGGGTCTATGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-915s1c1
Sequence:CCGGCAAGACACTTACAGCGTTCTACTCGAGTAGAACGCTGTAAGTGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-2605s1c1
Sequence:CCGGCGAATGAGCTTCTAAGGAGAACTCGAGTTCTCCTTAGAAGCTCATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013600.1-509s1c1
Sequence:CCGGCCAGAGAGTTCTGGATGAAATCTCGAGATTTCATCCAGAACTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)