EMAIL THIS PAGE TO A FRIEND

MSH6

mutS homolog 6

53 Gene Product Result for
Synonyms: GTBP GTMBP HNPCC5 HSAP p160
UniProtKB ID: P52701, O43706, O43917, Q8TCX4, Q9BTB5
Gene ID:
Human(2956) Summary: This gene encodes a protein similar to the MutS protein. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides, prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein of this gene combines with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene have been identified in individuals with hereditary nonpolyposis colon cancer (HNPCC) and endometrial cancer. [provided by RefSeq, Jul 2008]
Mouse(17688) mutS homolog 6 (E. coli)
Zebrafish(260437) mutS homolog 6 (E. coli)
fruit fly(39654) CG7003 gene product from transcript CG7003-RA
Thale Cress(828147) DNA mismatch repair protein MSH6
chicken(421291) mutS homolog 6 (E. coli)
cow(540526) mutS homolog 6 (E. coli)
domestic cat(101082303) mutS homolog 6 (E. coli)
dog(474585) mutS homolog 6 (E. coli)
Domestic Rabbit(100351645) mutS homolog 6 (E. coli)
naked mole-rat(101708261) mutS homolog 6 (E. coli)
domestic guinea pig(100725043) mutS homolog 6 (E. coli)
sheep(101107426) mutS homolog 6 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M2820 Anti-MSH6 (C-terminal) antibody produced in rabbit ~1 μg/L, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
M2445 Anti-MSH6 (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
HPA028376 Anti-MSH6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA028446 Anti-MSH6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry pricing
SAB4501333 Anti-MSH6 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB5500145 Anti-MSH6 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP93, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB2104682 Anti-MSH6, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rabbit, rat, horse, bovine, human, guinea pig
immunohistochemistry, western blot pricing
PLA0006 Goat anti-MSH6 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, human, chimpanzee, primate, gibbon
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing
WH0002956M1 Monoclonal Anti-MSH6 antibody produced in mouse clone 1F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing
SAB5300244 Monoclonal Anti-MSH6 antibody produced in mouse clone 3A10H7, ascites fluid human
ELISA, western blot pricing
SAB5300245 Monoclonal Anti-MSH6 antibody produced in mouse clone 5B11, ascites fluid human
ELISA, western blot pricing
SAB5300246 Monoclonal Anti-MSH6 antibody produced in mouse clone 3E1, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
PLA0007 Rabbit anti-MSH6 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, gibbon, marmoset, rhesus monkey, human, gorilla, chimpanzee
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000179 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000179 Rosetta Predictions human pricing
NM_010830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024426 predicted 1757
2 SASI_Hs01_00024427 predicted 1616
3 SASI_Hs01_00024429 predicted 1020
4 SASI_Hs01_00024430 predicted 2521
5 SASI_Hs01_00024431 predicted 1895
6 SASI_Hs02_00302020 predicted 1328
7 SASI_Hs01_00024432 predicted 1574
8 SASI_Hs01_00024433 predicted 3888
9 SASI_Hs01_00024434 predicted 1529
10 SASI_Hs01_00024435 predicted 2302
11 SASI_Hs01_00024428 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319452 predicted 1666
2 SASI_Mm01_00087374 predicted 3028
3 SASI_Mm02_00319453 predicted 1965
4 SASI_Mm01_00087379 predicted 3004
5 SASI_Mm01_00087380 predicted 3669
6 SASI_Mm02_00319454 predicted 1586
7 SASI_Mm02_00319455 predicted 1822
8 SASI_Mm01_00087383 predicted 2651
9 SASI_Mm02_00319456 predicted 1528
10 SASI_Mm02_00319457 predicted 1653
11 SASI_Mm01_00087375 predicted 4037
12 SASI_Mm01_00087376 predicted 977
13 SASI_Mm01_00087377 predicted 2856
14 SASI_Mm01_00087378 predicted 3652
15 SASI_Mm01_00087381 predicted 2636
16 SASI_Mm01_00087382 predicted 518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000179
VALIDATED
MSH6 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-3057s1c1
Sequence:CCGGGCCAGAAGAATACGAGTTGAACTCGAGTTCAACTCGTATTCTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-1329s1c1
Sequence:CCGGGCAGATTAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-3058s1c1
Sequence:CCGGCCAGAAGAATACGAGTTGAAACTCGAGTTTCAACTCGTATTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-3251s21c1
Sequence:CCGGGCGGCGACTGTTCTATAACTTCTCGAGAAGTTATAGAACAGTCGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-1394s21c1
Sequence:CCGGGCAGATTAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-3122s21c1
Sequence:CCGGGCCAGAAGAATACGAGTTGAACTCGAGTTCAACTCGTATTCTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-4265s21c1
Sequence:CCGGTTCTGACAAAGGTGGTAAATTCTCGAGAATTTACCACCTTTGTCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-867s21c1
Sequence:CCGGAGGCGAAGTAGCCGCCAAATACTCGAGTATTTGGCGGCTACTTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000179
VALIDATED
MSH6 MISSION shRNA shRNA Plasmid DNA
mutS homolog 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-3057s1c1
Sequence:CCGGGCCAGAAGAATACGAGTTGAACTCGAGTTCAACTCGTATTCTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-1329s1c1
Sequence:CCGGGCAGATTAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-3058s1c1
Sequence:CCGGCCAGAAGAATACGAGTTGAAACTCGAGTTTCAACTCGTATTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-3251s21c1
Sequence:CCGGGCGGCGACTGTTCTATAACTTCTCGAGAAGTTATAGAACAGTCGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-1394s21c1
Sequence:CCGGGCAGATTAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-3122s21c1
Sequence:CCGGGCCAGAAGAATACGAGTTGAACTCGAGTTCAACTCGTATTCTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-4265s21c1
Sequence:CCGGTTCTGACAAAGGTGGTAAATTCTCGAGAATTTACCACCTTTGTCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-867s21c1
Sequence:CCGGAGGCGAAGTAGCCGCCAAATACTCGAGTATTTGGCGGCTACTTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000179
VALIDATED
MSH6 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-3057s1c1
Sequence:CCGGGCCAGAAGAATACGAGTTGAACTCGAGTTCAACTCGTATTCTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-1329s1c1
Sequence:CCGGGCAGATTAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000179.1-3058s1c1
Sequence:CCGGCCAGAAGAATACGAGTTGAAACTCGAGTTTCAACTCGTATTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-3251s21c1
Sequence:CCGGGCGGCGACTGTTCTATAACTTCTCGAGAAGTTATAGAACAGTCGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-1394s21c1
Sequence:CCGGGCAGATTAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-3122s21c1
Sequence:CCGGGCCAGAAGAATACGAGTTGAACTCGAGTTCAACTCGTATTCTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-4265s21c1
Sequence:CCGGTTCTGACAAAGGTGGTAAATTCTCGAGAATTTACCACCTTTGTCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000179.2-867s21c1
Sequence:CCGGAGGCGAAGTAGCCGCCAAATACTCGAGTATTTGGCGGCTACTTCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010830
VALIDATED
MSH6 MISSION shRNA Bacterial Glycerol Stock
mutS homolog 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010830.1-2847s1c1
Sequence:CCGGGCAGGGTTTGACTCTGATTATCTCGAGATAATCAGAGTCAAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010830.1-4177s1c1
Sequence:CCGGGTGGTAAATTCAGACAACATTCTCGAGAATGTTGTCTGAATTTACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-3771s21c1
Sequence:CCGGGATAGCCAATGCGGTTGTTAACTCGAGTTAACAACCGCATTGGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010830.2-3050s21c1
Sequence:CCGGCCCGTAATCTACCTGAAGAATCTCGAGATTCTTCAGGTAGATTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-4013s21c1
Sequence:CCGGATCTCCCGGAGGAGGTTATTCCTCGAGGAATAACCTCCTCCGGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010830.2-2881s21c1
Sequence:CCGGGCAGGGTTTGACTCTGATTATCTCGAGATAATCAGAGTCAAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-1338s21c1
Sequence:CCGGGCAGCTCAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010830
VALIDATED
MSH6 MISSION shRNA shRNA Plasmid DNA
mutS homolog 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010830.1-2847s1c1
Sequence:CCGGGCAGGGTTTGACTCTGATTATCTCGAGATAATCAGAGTCAAACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010830.1-4177s1c1
Sequence:CCGGGTGGTAAATTCAGACAACATTCTCGAGAATGTTGTCTGAATTTACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-3771s21c1
Sequence:CCGGGATAGCCAATGCGGTTGTTAACTCGAGTTAACAACCGCATTGGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010830.2-3050s21c1
Sequence:CCGGCCCGTAATCTACCTGAAGAATCTCGAGATTCTTCAGGTAGATTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-4013s21c1
Sequence:CCGGATCTCCCGGAGGAGGTTATTCCTCGAGGAATAACCTCCTCCGGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010830.2-2881s21c1
Sequence:CCGGGCAGGGTTTGACTCTGATTATCTCGAGATAATCAGAGTCAAACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-1338s21c1
Sequence:CCGGGCAGCTCAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010830
VALIDATED
MSH6 MISSION shRNA Lentiviral Transduction Particles
mutS homolog 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010830.1-2847s1c1
Sequence:CCGGGCAGGGTTTGACTCTGATTATCTCGAGATAATCAGAGTCAAACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010830.1-4177s1c1
Sequence:CCGGGTGGTAAATTCAGACAACATTCTCGAGAATGTTGTCTGAATTTACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-3771s21c1
Sequence:CCGGGATAGCCAATGCGGTTGTTAACTCGAGTTAACAACCGCATTGGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010830.2-3050s21c1
Sequence:CCGGCCCGTAATCTACCTGAAGAATCTCGAGATTCTTCAGGTAGATTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-4013s21c1
Sequence:CCGGATCTCCCGGAGGAGGTTATTCCTCGAGGAATAACCTCCTCCGGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010830.2-2881s21c1
Sequence:CCGGGCAGGGTTTGACTCTGATTATCTCGAGATAATCAGAGTCAAACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010830.2-1338s21c1
Sequence:CCGGGCAGCTCAAGTCTCAGAACTTCTCGAGAAGTTCTGAGACTTGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)