EMAIL THIS PAGE TO A FRIEND

MSI1

musashi RNA-binding protein 1

69 Gene Product Result for
UniProtKB ID: O43347, Q96PU0, Q96PU1, Q96PU2, Q96PU3
Gene ID:
Human(4440) Summary: This gene encodes a protein containing two conserved tandem RNA recognition motifs. Similar proteins in other species function as RNA-binding proteins and play central roles in posttranscriptional gene regulation. Expression of this gene has been correlated with the grade of the malignancy and proliferative activity in gliomas and melanomas. A pseudogene for this gene is located on chromosome 11q13. [provided by RefSeq, Jul 2008]
Mouse(17690) musashi RNA-binding protein 1
Rat(259272) musashi RNA-binding protein 1
Zebrafish(541389) musashi homolog 1 (Drosophila)
dog(611488) musashi homolog 1 (Drosophila)
cow(527436) musashi homolog 1 (Drosophila)
domestic cat(101081170) musashi homolog 1 (Drosophila)
Thale Cress(835935) histone-binding protein MSI1
chicken(416979) musashi homolog 1 (Drosophila)
sheep(101112004) musashi homolog 1 (Drosophila)
domestic guinea pig(100733269) musashi RNA-binding protein 1
naked mole-rat(101698816) musashi RNA-binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200581 Anti-Msi-1 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200580 Anti-Msi-1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1406144 Anti-MSI1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1410797 Anti-MSI1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA064401 Anti-MSI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
M3571 Anti-Musashi-1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4100260 Monoclonal Anti-MSI1 antibody produced in mouse clone MSI1-A230, culture supernatant human
western blot pricing
SAB4100261 Monoclonal Anti-MSI1 antibody produced in mouse clone MSI1-B230, culture supernatant human
western blot pricing
SAB1409328 Monoclonal Anti-MSI1 antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409329 Monoclonal Anti-MSI1 antibody produced in mouse clone 4C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409330 Monoclonal Anti-MSI1 antibody produced in mouse clone 1C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404084 Monoclonal Anti-MSI1, (N-terminal) antibody produced in mouse clone 1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1402276 Monoclonal Anti-MSI1, (N-terminal) antibody produced in mouse clone 3F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU052671 MISSION® esiRNA esiRNA targeting mouse Msi1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002442 Rosetta Predictions human pricing
NM_148890 Rosetta Predictions rat pricing
XM_579678 Rosetta Predictions rat pricing
NM_008629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145278 predicted 474
2 SASI_Hs01_00145279 predicted 537
3 SASI_Hs01_00145280 predicted 655
4 SASI_Hs01_00145281 predicted 540
5 SASI_Hs02_00333845 predicted 369
6 SASI_Hs01_00145282 predicted 848
7 SASI_Hs01_00145283 predicted 549
8 SASI_Hs01_00145284 predicted 248
9 SASI_Hs01_00145285 predicted 712
10 SASI_Hs01_00145286 predicted 1119
11 SASI_Hs01_00145287 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041167 predicted 496
2 SASI_Rn02_00268895 predicted 504
3 SASI_Rn02_00268896 predicted 475
4 SASI_Rn01_00041168 predicted 456
5 SASI_Rn01_00041169 predicted 298
6 SASI_Rn01_00041170 predicted 634
7 SASI_Rn01_00041171 predicted 471
8 SASI_Rn01_00041172 predicted 495
9 SASI_Rn01_00041174 predicted 533
10 SASI_Rn01_00041175 predicted 610
11 SASI_Rn01_00041166 predicted 415
12 SASI_Rn01_00041173 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148945 predicted 315
2 SASI_Rn01_00148946 predicted 401
3 SASI_Rn01_00148947 predicted 358
4 SASI_Rn01_00148948 predicted 205
5 SASI_Rn01_00148949 predicted 540
6 SASI_Rn01_00148950 predicted 385
7 SASI_Rn01_00148951 predicted 400
8 SASI_Rn01_00148952 predicted 218
9 SASI_Rn01_00148953 predicted 447
10 SASI_Rn01_00148954 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040742 predicted 534
2 SASI_Mm01_00040743 predicted 557
3 SASI_Mm01_00040744 predicted 424
4 SASI_Mm01_00040746 predicted 342
5 SASI_Mm01_00040747 predicted 707
6 SASI_Mm01_00040748 predicted 1127
7 SASI_Mm01_00040749 predicted 1126
8 SASI_Mm01_00040750 predicted 852
9 SASI_Mm01_00040751 predicted 509
10 SASI_Mm02_00314333 predicted 603
11 SASI_Mm01_00040745 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002442
VALIDATED
MSI1 MISSION shRNA Bacterial Glycerol Stock
musashi RNA-binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-248s21c1
Sequence:CCGGGGTTTCGGCTTCGTCACTTTCCTCGAGGAAAGTGACGAAGCCGAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-1114s21c1
Sequence:CCGGCCCTTTGATTGCCACAGCCTTCTCGAGAAGGCTGTGGCAATCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002442.2-529s21c1
Sequence:CCGGCACGTTTGAGAGTGAGGACATCTCGAGATGTCCTCACTCTCAAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-285s1c1
Sequence:CCGGTGGATAAAGTGCTGGCGCAATCTCGAGATTGCGCCAGCACTTTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002442.2-529s1c1
Sequence:CCGGCACGTTTGAGAGTGAGGACATCTCGAGATGTCCTCACTCTCAAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-172s1c1
Sequence:CCGGGCGCGAATACTTCGGCCAGTTCTCGAGAACTGGCCGAAGTATTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-370s1c1
Sequence:CCGGCAAGATGGTGACTCGAACGAACTCGAGTTCGTTCGAGTCACCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-1114s1c1
Sequence:CCGGCCCTTTGATTGCCACAGCCTTCTCGAGAAGGCTGTGGCAATCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002442.2-471s21c1
Sequence:CCGGACGACGCCATGCTGATGTTTGCTCGAGCAAACATCAGCATGGCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-370s21c1
Sequence:CCGGCAAGATGGTGACTCGAACGAACTCGAGTTCGTTCGAGTCACCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002442
VALIDATED
MSI1 MISSION shRNA shRNA Plasmid DNA
musashi RNA-binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-248s21c1
Sequence:CCGGGGTTTCGGCTTCGTCACTTTCCTCGAGGAAAGTGACGAAGCCGAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-1114s21c1
Sequence:CCGGCCCTTTGATTGCCACAGCCTTCTCGAGAAGGCTGTGGCAATCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002442.2-529s21c1
Sequence:CCGGCACGTTTGAGAGTGAGGACATCTCGAGATGTCCTCACTCTCAAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-285s1c1
Sequence:CCGGTGGATAAAGTGCTGGCGCAATCTCGAGATTGCGCCAGCACTTTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002442.2-529s1c1
Sequence:CCGGCACGTTTGAGAGTGAGGACATCTCGAGATGTCCTCACTCTCAAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-172s1c1
Sequence:CCGGGCGCGAATACTTCGGCCAGTTCTCGAGAACTGGCCGAAGTATTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-370s1c1
Sequence:CCGGCAAGATGGTGACTCGAACGAACTCGAGTTCGTTCGAGTCACCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-1114s1c1
Sequence:CCGGCCCTTTGATTGCCACAGCCTTCTCGAGAAGGCTGTGGCAATCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002442.2-471s21c1
Sequence:CCGGACGACGCCATGCTGATGTTTGCTCGAGCAAACATCAGCATGGCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-370s21c1
Sequence:CCGGCAAGATGGTGACTCGAACGAACTCGAGTTCGTTCGAGTCACCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002442
VALIDATED
MSI1 MISSION shRNA Lentiviral Transduction Particles
musashi RNA-binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-248s21c1
Sequence:CCGGGGTTTCGGCTTCGTCACTTTCCTCGAGGAAAGTGACGAAGCCGAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-1114s21c1
Sequence:CCGGCCCTTTGATTGCCACAGCCTTCTCGAGAAGGCTGTGGCAATCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002442.2-529s21c1
Sequence:CCGGCACGTTTGAGAGTGAGGACATCTCGAGATGTCCTCACTCTCAAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-285s1c1
Sequence:CCGGTGGATAAAGTGCTGGCGCAATCTCGAGATTGCGCCAGCACTTTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002442.2-529s1c1
Sequence:CCGGCACGTTTGAGAGTGAGGACATCTCGAGATGTCCTCACTCTCAAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-172s1c1
Sequence:CCGGGCGCGAATACTTCGGCCAGTTCTCGAGAACTGGCCGAAGTATTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-370s1c1
Sequence:CCGGCAAGATGGTGACTCGAACGAACTCGAGTTCGTTCGAGTCACCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002442.2-1114s1c1
Sequence:CCGGCCCTTTGATTGCCACAGCCTTCTCGAGAAGGCTGTGGCAATCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002442.2-471s21c1
Sequence:CCGGACGACGCCATGCTGATGTTTGCTCGAGCAAACATCAGCATGGCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002442.2-370s21c1
Sequence:CCGGCAAGATGGTGACTCGAACGAACTCGAGTTCGTTCGAGTCACCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008629
VALIDATED
MSI1 MISSION shRNA Bacterial Glycerol Stock
musashi RNA-binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-425s21c1
Sequence:CCGGCGGTGGAAGATGTGAAACACTCTCGAGAGTGTTTCACATCTTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-1121s21c1
Sequence:CCGGTTGCCACAGCCTTCACCAATGCTCGAGCATTGGTGAAGGCTGTGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-570s21c1
Sequence:CCGGCCACTTCCATGAAATCAACAACTCGAGTTGTTGATTTCATGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008629.1-1335s21c1
Sequence:CCGGCCTGTTCAGACCTTGTCTCTTCTCGAGAAGAGACAAGGTCTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008629.1-1335s1c1
Sequence:CCGGCCTGTTCAGACCTTGTCTCTTCTCGAGAAGAGACAAGGTCTGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-425s1c1
Sequence:CCGGCGGTGGAAGATGTGAAACACTCTCGAGAGTGTTTCACATCTTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-438s21c1
Sequence:CCGGGAAACACTATTTCGAGCAGTTCTCGAGAACTGCTCGAAATAGTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-438s1c1
Sequence:CCGGGAAACACTATTTCGAGCAGTTCTCGAGAACTGCTCGAAATAGTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008629.1-570s1c1
Sequence:CCGGCCACTTCCATGAAATCAACAACTCGAGTTGTTGATTTCATGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-549s1c1
Sequence:CCGGCGTAGAGAAAGTTTGTGAGATCTCGAGATCTCACAAACTTTCTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008629
VALIDATED
MSI1 MISSION shRNA shRNA Plasmid DNA
musashi RNA-binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-425s21c1
Sequence:CCGGCGGTGGAAGATGTGAAACACTCTCGAGAGTGTTTCACATCTTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-1121s21c1
Sequence:CCGGTTGCCACAGCCTTCACCAATGCTCGAGCATTGGTGAAGGCTGTGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-570s21c1
Sequence:CCGGCCACTTCCATGAAATCAACAACTCGAGTTGTTGATTTCATGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008629.1-1335s21c1
Sequence:CCGGCCTGTTCAGACCTTGTCTCTTCTCGAGAAGAGACAAGGTCTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008629.1-1335s1c1
Sequence:CCGGCCTGTTCAGACCTTGTCTCTTCTCGAGAAGAGACAAGGTCTGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-425s1c1
Sequence:CCGGCGGTGGAAGATGTGAAACACTCTCGAGAGTGTTTCACATCTTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-438s21c1
Sequence:CCGGGAAACACTATTTCGAGCAGTTCTCGAGAACTGCTCGAAATAGTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-438s1c1
Sequence:CCGGGAAACACTATTTCGAGCAGTTCTCGAGAACTGCTCGAAATAGTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008629.1-570s1c1
Sequence:CCGGCCACTTCCATGAAATCAACAACTCGAGTTGTTGATTTCATGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-549s1c1
Sequence:CCGGCGTAGAGAAAGTTTGTGAGATCTCGAGATCTCACAAACTTTCTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008629
VALIDATED
MSI1 MISSION shRNA Lentiviral Transduction Particles
musashi RNA-binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-425s21c1
Sequence:CCGGCGGTGGAAGATGTGAAACACTCTCGAGAGTGTTTCACATCTTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-1121s21c1
Sequence:CCGGTTGCCACAGCCTTCACCAATGCTCGAGCATTGGTGAAGGCTGTGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-570s21c1
Sequence:CCGGCCACTTCCATGAAATCAACAACTCGAGTTGTTGATTTCATGGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008629.1-1335s21c1
Sequence:CCGGCCTGTTCAGACCTTGTCTCTTCTCGAGAAGAGACAAGGTCTGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008629.1-1335s1c1
Sequence:CCGGCCTGTTCAGACCTTGTCTCTTCTCGAGAAGAGACAAGGTCTGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-425s1c1
Sequence:CCGGCGGTGGAAGATGTGAAACACTCTCGAGAGTGTTTCACATCTTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008629.1-438s21c1
Sequence:CCGGGAAACACTATTTCGAGCAGTTCTCGAGAACTGCTCGAAATAGTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-438s1c1
Sequence:CCGGGAAACACTATTTCGAGCAGTTCTCGAGAACTGCTCGAAATAGTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008629.1-570s1c1
Sequence:CCGGCCACTTCCATGAAATCAACAACTCGAGTTGTTGATTTCATGGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008629.1-549s1c1
Sequence:CCGGCGTAGAGAAAGTTTGTGAGATCTCGAGATCTCACAAACTTTCTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)