EMAIL THIS PAGE TO A FRIEND

MSI2

musashi RNA-binding protein 2

121 Gene Product Result for
Synonyms: MSI2H
UniProtKB ID: Q96DH6, Q7Z6M7, Q8N9T4
Gene ID:
Human(124540) Summary: This gene encodes a protein containing two conserved tandem RNA recognition motifs. Similar proteins in other species function as RNA-binding proteins and play central roles in posttranscriptional gene regulation. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(76626) musashi RNA-binding protein 2
Rat(360596) musashi RNA-binding protein 2
domestic guinea pig(100727203) musashi RNA-binding protein 2
sheep(101102321) musashi homolog 2 (Drosophila)
Thale Cress(816179) WD-40 repeat-containing protein MSI2
chicken(417667) musashi homolog 2 (Drosophila)
dog(475148) musashi homolog 2 (Drosophila)
cow(505542) musashi homolog 2 (Drosophila)
domestic cat(101084147) musashi homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138962 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138962 Rosetta Predictions human pricing
NM_170721 Rosetta Predictions human pricing
XM_001081205 Rosetta Predictions rat pricing
XM_340876 Rosetta Predictions rat pricing
NM_054043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055452 predicted 646
2 SASI_Hs01_00055454 predicted 663
3 SASI_Hs02_00364013 predicted 485
4 SASI_Hs01_00055453 predicted 579
5 SASI_Hs02_00364014 predicted 673
6 SASI_Hs01_00055455 predicted 619
7 SASI_Hs01_00055456 predicted 668
8 SASI_Hs02_00364015 predicted 513
9 SASI_Hs01_00055458 predicted 582
10 SASI_Hs01_00055459 predicted 476
11 SASI_Hs01_00055457 predicted 535
12 SASI_Hs01_00055460 predicted 539
13 SASI_Hs01_00055461 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053640 predicted 492
2 SASI_Hs01_00053642 predicted 508
3 SASI_Hs02_00367678 predicted 336
4 SASI_Hs01_00053641 predicted 436
5 SASI_Hs02_00367679 predicted 519
6 SASI_Hs01_00053643 predicted 468
7 SASI_Hs01_00053644 predicted 527
8 SASI_Hs02_00367680 predicted 361
9 SASI_Hs01_00053646 predicted 436
10 SASI_Hs01_00053647 predicted 321
11 SASI_Hs01_00053645 predicted 388
12 SASI_Hs01_00053648 predicted 396
13 SASI_Hs01_00053649 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371034 predicted 602
2 SASI_Rn02_00371035 predicted 990
3 SASI_Rn02_00371036 predicted 971
4 SASI_Rn02_00371037 predicted 1483
5 SASI_Rn02_00371038 predicted 1095
6 SASI_Rn02_00371039 predicted 492
7 SASI_Rn02_00371040 predicted 223
8 SASI_Rn02_00371041 predicted 1284
9 SASI_Rn02_00371042 predicted 733
10 SASI_Rn02_00371043 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392060 predicted 421
2 SASI_Rn02_00392061 predicted 412
3 SASI_Rn02_00392062 predicted 527
4 SASI_Rn02_00392063 predicted 403
5 SASI_Rn02_00392064 predicted 1037
6 SASI_Rn02_00392065 predicted 1075
7 SASI_Rn02_00392066 predicted 719
8 SASI_Rn02_00392067 predicted 597
9 SASI_Rn02_00392068 predicted 966
10 SASI_Rn02_00392069 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192425 predicted 438
2 SASI_Mm01_00192426 predicted 749
3 SASI_Mm01_00192427 predicted 609
4 SASI_Mm01_00192428 predicted 642
5 SASI_Mm01_00192429 predicted 631
6 SASI_Mm01_00192430 predicted 1140
7 SASI_Mm01_00192431 predicted 354
8 SASI_Mm02_00337949 predicted 705
9 SASI_Mm02_00337950 predicted 705
10 SASI_Mm01_00192432 predicted 388
11 SASI_Mm01_00192433 predicted 941
12 SASI_Mm01_00192434 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054043
VALIDATED
MSI2 MISSION shRNA Bacterial Glycerol Stock
musashi RNA-binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-1537s1c1
Sequence:CCGGCCCAGCTTAATATCTAGTTAACTCGAGTTAACTAGATATTAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-797s1c1
Sequence:CCGGCCCAACTTTGTGGCAACCTATCTCGAGATAGGTTGCCACAAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-478s1c1
Sequence:CCGGCGTAGGAGGATTGTCTGCAAACTCGAGTTTGCAGACAATCCTCCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-385s1c1
Sequence:CCGGCCACCATGAGTTAGATTCCAACTCGAGTTGGAATCTAACTCATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-939s1c1
Sequence:CCGGGCTACAGTGCTCAACCGAATTCTCGAGAATTCGGTTGAGCACTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-385s21c1
Sequence:CCGGCCACCATGAGTTAGATTCCAACTCGAGTTGGAATCTAACTCATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-797s21c1
Sequence:CCGGCCCAACTTTGTGGCAACCTATCTCGAGATAGGTTGCCACAAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054043.3-1537s21c1
Sequence:CCGGCCCAGCTTAATATCTAGTTAACTCGAGTTAACTAGATATTAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-478s21c1
Sequence:CCGGCGTAGGAGGATTGTCTGCAAACTCGAGTTTGCAGACAATCCTCCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-939s21c1
Sequence:CCGGGCTACAGTGCTCAACCGAATTCTCGAGAATTCGGTTGAGCACTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054043
VALIDATED
MSI2 MISSION shRNA shRNA Plasmid DNA
musashi RNA-binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-1537s1c1
Sequence:CCGGCCCAGCTTAATATCTAGTTAACTCGAGTTAACTAGATATTAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-797s1c1
Sequence:CCGGCCCAACTTTGTGGCAACCTATCTCGAGATAGGTTGCCACAAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-478s1c1
Sequence:CCGGCGTAGGAGGATTGTCTGCAAACTCGAGTTTGCAGACAATCCTCCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-385s1c1
Sequence:CCGGCCACCATGAGTTAGATTCCAACTCGAGTTGGAATCTAACTCATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-939s1c1
Sequence:CCGGGCTACAGTGCTCAACCGAATTCTCGAGAATTCGGTTGAGCACTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-385s21c1
Sequence:CCGGCCACCATGAGTTAGATTCCAACTCGAGTTGGAATCTAACTCATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-797s21c1
Sequence:CCGGCCCAACTTTGTGGCAACCTATCTCGAGATAGGTTGCCACAAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054043.3-1537s21c1
Sequence:CCGGCCCAGCTTAATATCTAGTTAACTCGAGTTAACTAGATATTAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-478s21c1
Sequence:CCGGCGTAGGAGGATTGTCTGCAAACTCGAGTTTGCAGACAATCCTCCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-939s21c1
Sequence:CCGGGCTACAGTGCTCAACCGAATTCTCGAGAATTCGGTTGAGCACTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054043
VALIDATED
MSI2 MISSION shRNA Lentiviral Transduction Particles
musashi RNA-binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-1537s1c1
Sequence:CCGGCCCAGCTTAATATCTAGTTAACTCGAGTTAACTAGATATTAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-797s1c1
Sequence:CCGGCCCAACTTTGTGGCAACCTATCTCGAGATAGGTTGCCACAAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-478s1c1
Sequence:CCGGCGTAGGAGGATTGTCTGCAAACTCGAGTTTGCAGACAATCCTCCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-385s1c1
Sequence:CCGGCCACCATGAGTTAGATTCCAACTCGAGTTGGAATCTAACTCATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054043.2-939s1c1
Sequence:CCGGGCTACAGTGCTCAACCGAATTCTCGAGAATTCGGTTGAGCACTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-385s21c1
Sequence:CCGGCCACCATGAGTTAGATTCCAACTCGAGTTGGAATCTAACTCATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-797s21c1
Sequence:CCGGCCCAACTTTGTGGCAACCTATCTCGAGATAGGTTGCCACAAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054043.3-1537s21c1
Sequence:CCGGCCCAGCTTAATATCTAGTTAACTCGAGTTAACTAGATATTAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-478s21c1
Sequence:CCGGCGTAGGAGGATTGTCTGCAAACTCGAGTTTGCAGACAATCCTCCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054043.3-939s21c1
Sequence:CCGGGCTACAGTGCTCAACCGAATTCTCGAGAATTCGGTTGAGCACTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138962
VALIDATED
MSI2 MISSION shRNA Bacterial Glycerol Stock
musashi RNA-binding protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-275s1c1
Sequence:CCGGAGATAGCCTTAGAGACTATTTCTCGAGAAATAGTCTCTAAGGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-831s1c1
Sequence:CCGGCCCAACTTCGTGGCGACCTATCTCGAGATAGGTCGCCACGAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-540s1c1
Sequence:CCGGGTGGAAGATGTAAAGCAATATCTCGAGATATTGCTTTACATCTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-387s1c1
Sequence:CCGGCCAGCAAGTGTAGATAAAGTACTCGAGTACTTTATCTACACTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-785s21c1
Sequence:CCGCTTACACCATGGACGCGTTCATCTCGAGATGAACGCGTCCATGGTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-587s21c1
Sequence:CCGGTGCAATGCTGATGTTTGATAACTCGAGTTATCAAACATCAGCATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138962.2-1312s21c1
Sequence:CCGGCTTCGGATCGAGGGTTGACTACTCGAGTAGTCAACCCTCGATCCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-1123s21c1
Sequence:CCGGCTTTGATTGCAACGGCCTTTACTCGAGTAAAGGCCGTTGCAATCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138962
VALIDATED
MSI2 MISSION shRNA shRNA Plasmid DNA
musashi RNA-binding protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-275s1c1
Sequence:CCGGAGATAGCCTTAGAGACTATTTCTCGAGAAATAGTCTCTAAGGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-831s1c1
Sequence:CCGGCCCAACTTCGTGGCGACCTATCTCGAGATAGGTCGCCACGAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-540s1c1
Sequence:CCGGGTGGAAGATGTAAAGCAATATCTCGAGATATTGCTTTACATCTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-387s1c1
Sequence:CCGGCCAGCAAGTGTAGATAAAGTACTCGAGTACTTTATCTACACTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-785s21c1
Sequence:CCGCTTACACCATGGACGCGTTCATCTCGAGATGAACGCGTCCATGGTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-587s21c1
Sequence:CCGGTGCAATGCTGATGTTTGATAACTCGAGTTATCAAACATCAGCATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138962.2-1312s21c1
Sequence:CCGGCTTCGGATCGAGGGTTGACTACTCGAGTAGTCAACCCTCGATCCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-1123s21c1
Sequence:CCGGCTTTGATTGCAACGGCCTTTACTCGAGTAAAGGCCGTTGCAATCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138962
VALIDATED
MSI2 MISSION shRNA Lentiviral Transduction Particles
musashi RNA-binding protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-275s1c1
Sequence:CCGGAGATAGCCTTAGAGACTATTTCTCGAGAAATAGTCTCTAAGGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-831s1c1
Sequence:CCGGCCCAACTTCGTGGCGACCTATCTCGAGATAGGTCGCCACGAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-540s1c1
Sequence:CCGGGTGGAAGATGTAAAGCAATATCTCGAGATATTGCTTTACATCTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_138962.2-387s1c1
Sequence:CCGGCCAGCAAGTGTAGATAAAGTACTCGAGTACTTTATCTACACTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-785s21c1
Sequence:CCGCTTACACCATGGACGCGTTCATCTCGAGATGAACGCGTCCATGGTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-587s21c1
Sequence:CCGGTGCAATGCTGATGTTTGATAACTCGAGTTATCAAACATCAGCATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138962.2-1312s21c1
Sequence:CCGGCTTCGGATCGAGGGTTGACTACTCGAGTAGTCAACCCTCGATCCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138962.2-1123s21c1
Sequence:CCGGCTTTGATTGCAACGGCCTTTACTCGAGTAAAGGCCGTTGCAATCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)