EMAIL THIS PAGE TO A FRIEND

MSL2

male-specific lethal 2 homolog (Drosophila)

233 Gene Product Result for
Synonyms: MSL-2 MSL2L1 RNF184
UniProtKB ID: Q9HCI7, B4DYL4, G5E9I1, Q0D2P1, Q8NDB4, Q9NVS4
Gene ID:
Mouse(77853) male-specific lethal 2 homolog (Drosophila)
Rat(315959) male-specific lethal 2 homolog (Drosophila)
Thale Cress(830913) mechanosensitive ion channel protein 2
cow(525740) male-specific lethal 2 homolog (Drosophila)
Horse(100065902) male-specific lethal 2 homolog (Drosophila)
domestic cat(101083106) male-specific lethal 2 homolog (Drosophila)
dog(485673) male-specific lethal 2 homolog (Drosophila)
chicken(429119) male-specific lethal 2 homolog (Drosophila)
naked mole-rat(101698122) male-specific lethal 2 homolog (Drosophila)
domestic guinea pig(100729291) male-specific lethal 2 homolog (Drosophila)
sheep(101113815) male-specific lethal 2 homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_150227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_150227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_150227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018133 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018133 Rosetta Predictions human pricing
XM_001071576 Rosetta Predictions rat pricing
XM_236567 Rosetta Predictions rat pricing
XM_150227 Rosetta Predictions mouse pricing
XM_907909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100880 predicted 2106
2 SASI_Hs01_00100881 predicted 1010
3 SASI_Hs01_00100882 predicted 2069
4 SASI_Hs01_00100883 predicted 1238
5 SASI_Hs01_00100884 predicted 1063
6 SASI_Hs01_00100885 predicted 803
7 SASI_Hs01_00100886 predicted 2307
8 SASI_Hs01_00100887 predicted 1098
9 SASI_Hs01_00100888 predicted 2518
10 SASI_Hs01_00100889 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335596 predicted 2017
2 SASI_Rn02_00335597 predicted 1694
3 SASI_Rn02_00335598 predicted 1932
4 SASI_Rn02_00335599 predicted 1170
5 SASI_Rn02_00335600 predicted 1512
6 SASI_Rn02_00335601 predicted 2913
7 SASI_Rn02_00335602 predicted 1392
8 SASI_Rn02_00335603 predicted 1674
9 SASI_Rn02_00335604 predicted 2332
10 SASI_Rn02_00335605 predicted 2876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390149 predicted 2014
2 SASI_Rn02_00390150 predicted 1693
3 SASI_Rn02_00390151 predicted 1939
4 SASI_Rn02_00390152 predicted 1163
5 SASI_Rn02_00390153 predicted 1514
6 SASI_Rn02_00390154 predicted 2911
7 SASI_Rn02_00390155 predicted 1389
8 SASI_Rn02_00390156 predicted 1671
9 SASI_Rn02_00390157 predicted 2338
10 SASI_Rn02_00390158 predicted 2876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_150227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276105 predicted 378
2 SASI_Mm01_00276106 predicted 1635
3 SASI_Mm01_00276107 predicted 1714
4 SASI_Mm01_00276108 predicted 518
5 SASI_Mm01_00276109 predicted 705
6 SASI_Mm02_00425396 predicted 1832
7 SASI_Mm01_00276110 predicted 1735
8 SASI_Mm01_00276111 predicted 1238
9 SASI_Mm01_00276112 predicted 1592
10 SASI_Mm01_00276113 predicted 615
11 SASI_Mm01_00276114 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433605 predicted 1914
2 SASI_Mm02_00433606 predicted 285
3 SASI_Mm02_00433607 predicted 709
4 SASI_Mm02_00433608 predicted 892
5 SASI_Mm02_00433609 predicted 2024
6 SASI_Mm02_00433610 predicted 1925
7 SASI_Mm02_00433611 predicted 1435
8 SASI_Mm02_00433612 predicted 1783
9 SASI_Mm02_00433613 predicted 812
10 SASI_Mm02_00433614 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_150227
MSL2 MISSION shRNA Bacterial Glycerol Stock
male-specific lethal 2 homolog (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-935s21c1
Sequence:CCGGCCCAGTCTCTTAGCCATAATGCTCGAGCATTATGGCTAAGAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-349s21c1
Sequence:CCGGACGACACTGGCACGGGATATACTCGAGTATATCCCGTGCCAGTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-515s21c1
Sequence:CCGGCTGATCCTCAAGCTAGCTTATCTCGAGATAAGCTAGCTTGAGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-44s21c1
Sequence:CCGGAGTCTAGTGAGTCTAACAAATCTCGAGATTTGTTAGACTCACTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-861s21c1
Sequence:CCGGAGAAGTTTGCTGTCCTAATTTCTCGAGAAATTAGGACAGCAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_150227
MSL2 MISSION shRNA shRNA Plasmid DNA
male-specific lethal 2 homolog (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-935s21c1
Sequence:CCGGCCCAGTCTCTTAGCCATAATGCTCGAGCATTATGGCTAAGAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-349s21c1
Sequence:CCGGACGACACTGGCACGGGATATACTCGAGTATATCCCGTGCCAGTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-515s21c1
Sequence:CCGGCTGATCCTCAAGCTAGCTTATCTCGAGATAAGCTAGCTTGAGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-44s21c1
Sequence:CCGGAGTCTAGTGAGTCTAACAAATCTCGAGATTTGTTAGACTCACTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-861s21c1
Sequence:CCGGAGAAGTTTGCTGTCCTAATTTCTCGAGAAATTAGGACAGCAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_150227
MSL2 MISSION shRNA Lentiviral Transduction Particles
male-specific lethal 2 homolog (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-935s21c1
Sequence:CCGGCCCAGTCTCTTAGCCATAATGCTCGAGCATTATGGCTAAGAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-349s21c1
Sequence:CCGGACGACACTGGCACGGGATATACTCGAGTATATCCCGTGCCAGTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-515s21c1
Sequence:CCGGCTGATCCTCAAGCTAGCTTATCTCGAGATAAGCTAGCTTGAGGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-44s21c1
Sequence:CCGGAGTCTAGTGAGTCTAACAAATCTCGAGATTTGTTAGACTCACTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_150227.8-861s21c1
Sequence:CCGGAGAAGTTTGCTGTCCTAATTTCTCGAGAAATTAGGACAGCAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018133
VALIDATED
MSL2 MISSION shRNA Bacterial Glycerol Stock
male-specific lethal 2 homolog (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-1656s21c1
Sequence:CCGGCCCAGTCTCTTAGCCATAATGCTCGAGCATTATGGCTAAGAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-1367s1c1
Sequence:CCGGCCTGAACATTCAAATACGATTCTCGAGAATCGTATTTGAATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018133.2-1082s1c1
Sequence:CCGGCGGGATATAATAGAAGCAGTTCTCGAGAACTGCTTCTATTATATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018133.2-807s1c1
Sequence:CCGGCCAAGGCGTTTACTGAGATTACTCGAGTAATCTCAGTAAACGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-2177s1c1
Sequence:CCGGCCTTGCTACTCTAACCGCAAACTCGAGTTTGCGGTTAGAGTAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-1793s1c1
Sequence:CCGGCCACTTCCAATTTCTACCATTCTCGAGAATGGTAGAAATTGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018133.3-2177s21c1
Sequence:CCGGCCTTGCTACTCTAACCGCAAACTCGAGTTTGCGGTTAGAGTAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-1471s21c1
Sequence:CCGGATGTTCCACAGGCATTGATATCTCGAGATATCAATGCCTGTGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018133.3-2546s21c1
Sequence:CCGGTTGCCGGAGCTCCTGCATATACTCGAGTATATGCAGGAGCTCCGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-907s21c1
Sequence:CCGGCAACTCCACCTGCCAACATTACTCGAGTAATGTTGGCAGGTGGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018133
VALIDATED
MSL2 MISSION shRNA shRNA Plasmid DNA
male-specific lethal 2 homolog (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-1656s21c1
Sequence:CCGGCCCAGTCTCTTAGCCATAATGCTCGAGCATTATGGCTAAGAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-1367s1c1
Sequence:CCGGCCTGAACATTCAAATACGATTCTCGAGAATCGTATTTGAATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018133.2-1082s1c1
Sequence:CCGGCGGGATATAATAGAAGCAGTTCTCGAGAACTGCTTCTATTATATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018133.2-807s1c1
Sequence:CCGGCCAAGGCGTTTACTGAGATTACTCGAGTAATCTCAGTAAACGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-2177s1c1
Sequence:CCGGCCTTGCTACTCTAACCGCAAACTCGAGTTTGCGGTTAGAGTAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-1793s1c1
Sequence:CCGGCCACTTCCAATTTCTACCATTCTCGAGAATGGTAGAAATTGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018133.3-2177s21c1
Sequence:CCGGCCTTGCTACTCTAACCGCAAACTCGAGTTTGCGGTTAGAGTAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-1471s21c1
Sequence:CCGGATGTTCCACAGGCATTGATATCTCGAGATATCAATGCCTGTGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018133.3-2546s21c1
Sequence:CCGGTTGCCGGAGCTCCTGCATATACTCGAGTATATGCAGGAGCTCCGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-907s21c1
Sequence:CCGGCAACTCCACCTGCCAACATTACTCGAGTAATGTTGGCAGGTGGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018133
VALIDATED
MSL2 MISSION shRNA Lentiviral Transduction Particles
male-specific lethal 2 homolog (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-1656s21c1
Sequence:CCGGCCCAGTCTCTTAGCCATAATGCTCGAGCATTATGGCTAAGAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-1367s1c1
Sequence:CCGGCCTGAACATTCAAATACGATTCTCGAGAATCGTATTTGAATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018133.2-1082s1c1
Sequence:CCGGCGGGATATAATAGAAGCAGTTCTCGAGAACTGCTTCTATTATATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018133.2-807s1c1
Sequence:CCGGCCAAGGCGTTTACTGAGATTACTCGAGTAATCTCAGTAAACGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-2177s1c1
Sequence:CCGGCCTTGCTACTCTAACCGCAAACTCGAGTTTGCGGTTAGAGTAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018133.2-1793s1c1
Sequence:CCGGCCACTTCCAATTTCTACCATTCTCGAGAATGGTAGAAATTGGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018133.3-2177s21c1
Sequence:CCGGCCTTGCTACTCTAACCGCAAACTCGAGTTTGCGGTTAGAGTAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-1471s21c1
Sequence:CCGGATGTTCCACAGGCATTGATATCTCGAGATATCAATGCCTGTGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018133.3-2546s21c1
Sequence:CCGGTTGCCGGAGCTCCTGCATATACTCGAGTATATGCAGGAGCTCCGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018133.3-907s21c1
Sequence:CCGGCAACTCCACCTGCCAACATTACTCGAGTAATGTTGGCAGGTGGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)