EMAIL THIS PAGE TO A FRIEND

MSLN

mesothelin

212 Gene Product Result for
Synonyms: MPF SMRP
Gene ID:
Human(10232) Summary: This gene encodes a precursor protein that is cleaved into two products, megakaryocyte potentiating factor and mesothelin. Megakaryocyte potentiation factor functions as a cytokine that can stimulate colony formation in bone marrow megakaryocytes. Mesothelian is a glycosylphosphatidylinositol-anchored cell-surface protein that may function as a cell adhesion protein. This protein is overexpressed in epithelial mesotheliomas, ovarian cancers and in specific squamous cell carcinomas. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
Mouse(56047) mesothelin
Rat(60333) mesothelin
chicken(416534) mesothelin
dog(611363) mesothelin
cow(516237) mesothelin
sheep(101111680) mesothelin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0713 Human MSLN / Mesothelin ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005823 Rosetta Predictions human pricing
NM_013404 Rosetta Predictions human pricing
NM_031658 Rosetta Predictions rat pricing
NM_018857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232825 predicted 461
2 SASI_Hs01_00232826 predicted 399
3 SASI_Hs01_00232827 predicted 959
4 SASI_Hs01_00232828 predicted 959
5 SASI_Hs01_00232829 predicted 1644
6 SASI_Hs01_00232830 predicted 1573
7 SASI_Hs01_00232831 predicted 765
8 SASI_Hs01_00232832 predicted 955
9 SASI_Hs01_00232833 predicted 312
10 SASI_Hs01_00232834 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160555 predicted 457
2 SASI_Hs01_00160556 predicted 404
3 SASI_Hs01_00160557 predicted 965
4 SASI_Hs01_00160558 predicted 960
5 SASI_Hs01_00160559 predicted 1667
6 SASI_Hs01_00160560 predicted 1596
7 SASI_Hs01_00160561 predicted 765
8 SASI_Hs01_00160562 predicted 962
9 SASI_Hs01_00160563 predicted 314
10 SASI_Hs01_00160564 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265001 predicted 881
2 SASI_Rn01_00066508 predicted 943
3 SASI_Rn01_00066509 predicted 1439
4 SASI_Rn01_00066510 predicted 607
5 SASI_Rn01_00066511 predicted 1636
6 SASI_Rn01_00066512 predicted 590
7 SASI_Rn01_00066513 predicted 674
8 SASI_Rn01_00066514 predicted 893
9 SASI_Rn01_00066515 predicted 519
10 SASI_Rn01_00066517 predicted 362
11 SASI_Rn01_00066516 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127247 predicted 1138
2 SASI_Mm01_00127248 predicted 962
3 SASI_Mm01_00127249 predicted 1030
4 SASI_Mm01_00127250 predicted 914
5 SASI_Mm02_00324213 predicted 290
6 SASI_Mm01_00127251 predicted 1666
7 SASI_Mm01_00127252 predicted 364
8 SASI_Mm01_00127253 predicted 400
9 SASI_Mm02_00324214 predicted 1050
10 SASI_Mm01_00127255 predicted 1228
11 SASI_Mm01_00127254 predicted 1307
12 SASI_Mm01_00127256 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013404
MSLN MISSION shRNA Bacterial Glycerol Stock
mesothelin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-206s21c1
Sequence:CCGGTGGCCAACCCACCTAACATTTCTCGAGAAATGTTAGGTGGGTTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1097s21c1
Sequence:CCGGTGGACGTCCTAAAGCATAAACCTCGAGGTTTATGCTTTAGGACGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1347s21c1
Sequence:CCGGGCTAGACAAAGACACCCTAGACTCGAGTCTAGGGTGTCTTTGTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013404.1-346s1c1
Sequence:CCGGCTTGGCACAGAAGAATGTCAACTCGAGTTGACATTCTTCTGTGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1530s21c1
Sequence:CCGGGAACATGAACGGGTCCGAATACTCGAGTATTCGGACCCGTTCATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1251s21c1
Sequence:CCGGAGTCAACAAAGGGCACGAAATCTCGAGATTTCGTGCCCTTTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013404
MSLN MISSION shRNA shRNA Plasmid DNA
mesothelin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-206s21c1
Sequence:CCGGTGGCCAACCCACCTAACATTTCTCGAGAAATGTTAGGTGGGTTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1097s21c1
Sequence:CCGGTGGACGTCCTAAAGCATAAACCTCGAGGTTTATGCTTTAGGACGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1347s21c1
Sequence:CCGGGCTAGACAAAGACACCCTAGACTCGAGTCTAGGGTGTCTTTGTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013404.1-346s1c1
Sequence:CCGGCTTGGCACAGAAGAATGTCAACTCGAGTTGACATTCTTCTGTGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1530s21c1
Sequence:CCGGGAACATGAACGGGTCCGAATACTCGAGTATTCGGACCCGTTCATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1251s21c1
Sequence:CCGGAGTCAACAAAGGGCACGAAATCTCGAGATTTCGTGCCCTTTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013404
MSLN MISSION shRNA Lentiviral Transduction Particles
mesothelin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-206s21c1
Sequence:CCGGTGGCCAACCCACCTAACATTTCTCGAGAAATGTTAGGTGGGTTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1097s21c1
Sequence:CCGGTGGACGTCCTAAAGCATAAACCTCGAGGTTTATGCTTTAGGACGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1347s21c1
Sequence:CCGGGCTAGACAAAGACACCCTAGACTCGAGTCTAGGGTGTCTTTGTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013404.1-346s1c1
Sequence:CCGGCTTGGCACAGAAGAATGTCAACTCGAGTTGACATTCTTCTGTGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1530s21c1
Sequence:CCGGGAACATGAACGGGTCCGAATACTCGAGTATTCGGACCCGTTCATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013404.3-1251s21c1
Sequence:CCGGAGTCAACAAAGGGCACGAAATCTCGAGATTTCGTGCCCTTTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018857
MSLN MISSION shRNA Bacterial Glycerol Stock
mesothelin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1578s1c1
Sequence:CCGGCGGCCTAGAATACTTTGAGAACTCGAGTTCTCAAAGTATTCTAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1112s1c1
Sequence:CCGGCCAGACAAATGGACCTTGTGACTCGAGTCACAAGGTCCATTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1665s1c1
Sequence:CCGGCATGGACATAGCCACTTTCAACTCGAGTTGAAAGTGGCTATGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-175s1c1
Sequence:CCGGCTACTGCTTCTCCTTAGTCTTCTCGAGAAGACTAAGGAGAAGCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-622s1c1
Sequence:CCGGCAGGGCGTGTATGGATTTCAACTCGAGTTGAAATCCATACACGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018857
MSLN MISSION shRNA shRNA Plasmid DNA
mesothelin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1578s1c1
Sequence:CCGGCGGCCTAGAATACTTTGAGAACTCGAGTTCTCAAAGTATTCTAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1112s1c1
Sequence:CCGGCCAGACAAATGGACCTTGTGACTCGAGTCACAAGGTCCATTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1665s1c1
Sequence:CCGGCATGGACATAGCCACTTTCAACTCGAGTTGAAAGTGGCTATGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-175s1c1
Sequence:CCGGCTACTGCTTCTCCTTAGTCTTCTCGAGAAGACTAAGGAGAAGCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-622s1c1
Sequence:CCGGCAGGGCGTGTATGGATTTCAACTCGAGTTGAAATCCATACACGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018857
MSLN MISSION shRNA Lentiviral Transduction Particles
mesothelin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1578s1c1
Sequence:CCGGCGGCCTAGAATACTTTGAGAACTCGAGTTCTCAAAGTATTCTAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1112s1c1
Sequence:CCGGCCAGACAAATGGACCTTGTGACTCGAGTCACAAGGTCCATTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-1665s1c1
Sequence:CCGGCATGGACATAGCCACTTTCAACTCGAGTTGAAAGTGGCTATGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-175s1c1
Sequence:CCGGCTACTGCTTCTCCTTAGTCTTCTCGAGAAGACTAAGGAGAAGCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018857.1-622s1c1
Sequence:CCGGCAGGGCGTGTATGGATTTCAACTCGAGTTGAAATCCATACACGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)