EMAIL THIS PAGE TO A FRIEND

MSLNL

mesothelin-like

48 Gene Product Result for
Synonyms: C16orf37 MPFL
UniProtKB ID: Q96KJ4
Gene ID:
Mouse(328783) mesothelin-like
Rat(363554) mesothelin-like
chicken(770761) mesothelin-like
dog(100686529) mesothelin-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025190 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025551 MISSION® esiRNA esiRNA targeting mouse Mslnl (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025190 Rosetta Predictions human pricing
XM_001060231 Rosetta Predictions rat pricing
XM_343869 Rosetta Predictions rat pricing
NM_177822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236926 predicted 2010
2 SASI_Hs01_00236927 predicted 1683
3 SASI_Hs01_00236928 predicted 413
4 SASI_Hs01_00236929 predicted 2043
5 SASI_Hs01_00236930 predicted 649
6 SASI_Hs02_00307390 predicted 1069
7 SASI_Hs01_00236931 predicted 1222
8 SASI_Hs01_00236933 predicted 532
9 SASI_Hs01_00236935 predicted 637
10 SASI_Hs02_00307391 predicted 1682
11 SASI_Hs01_00236932 predicted 351
12 SASI_Hs01_00236934 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295783 predicted 340
2 SASI_Rn02_00295784 predicted 841
3 SASI_Rn02_00295785 predicted 1984
4 SASI_Rn02_00295786 predicted 1889
5 SASI_Rn02_00295787 predicted 515
6 SASI_Rn02_00295788 predicted 1672
7 SASI_Rn02_00295789 predicted 1680
8 SASI_Rn02_00295790 predicted 1521
9 SASI_Rn02_00295791 predicted 259
10 SASI_Rn02_00295792 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396497 predicted 1983
2 SASI_Rn02_00396498 predicted 2030
3 SASI_Rn02_00396499 predicted 2028
4 SASI_Rn02_00396500 predicted 2030
5 SASI_Rn02_00396501 predicted 2033
6 SASI_Rn02_00396502 predicted 1948
7 SASI_Rn02_00396503 predicted 1915
8 SASI_Rn02_00396504 predicted 2028
9 SASI_Rn02_00396505 predicted 1946
10 SASI_Rn02_00396506 predicted 2034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120370 predicted 2302
2 SASI_Mm01_00120371 predicted 1801
3 SASI_Mm01_00120372 predicted 705
4 SASI_Mm01_00120373 predicted 2265
5 SASI_Mm01_00120374 predicted 1316
6 SASI_Mm01_00120375 predicted 1427
7 SASI_Mm01_00120377 predicted 2263
8 SASI_Mm01_00120378 predicted 2278
9 SASI_Mm01_00120379 predicted 1896
10 SASI_Mm02_00348282 predicted 1792
11 SASI_Mm01_00120376 predicted 1960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025190
MSLNL MISSION shRNA Bacterial Glycerol Stock
mesothelin-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-2306s21c1
Sequence:CCGGAGAAGTTTCTGGAGCACAATGCTCGAGCATTGTGCTCCAGAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-461s21c1
Sequence:CCGGCGTGCACACTGTCACCTACATCTCGAGATGTAGGTGACAGTGTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-814s21c1
Sequence:CCGGACCCTCACAGCCCACCTTATTCTCGAGAATAAGGTGGGCTGTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-419s21c1
Sequence:CCGGTCTCATGCCTGTGCTGTATACCTCGAGGTATACAGCACAGGCATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025190.1-2304s1c1
Sequence:CCGGGCAGAAGTTTCTGGAGCACAACTCGAGTTGTGCTCCAGAAACTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025190.1-1323s1c1
Sequence:CCGGCAACCTGCTGCTCTTCTACAACTCGAGTTGTAGAAGAGCAGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-526s21c1
Sequence:CCGGCCTCATGCCTGTGCTGTATACCTCGAGGTATACAGCACAGGCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025190
MSLNL MISSION shRNA shRNA Plasmid DNA
mesothelin-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-2306s21c1
Sequence:CCGGAGAAGTTTCTGGAGCACAATGCTCGAGCATTGTGCTCCAGAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-461s21c1
Sequence:CCGGCGTGCACACTGTCACCTACATCTCGAGATGTAGGTGACAGTGTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-814s21c1
Sequence:CCGGACCCTCACAGCCCACCTTATTCTCGAGAATAAGGTGGGCTGTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-419s21c1
Sequence:CCGGTCTCATGCCTGTGCTGTATACCTCGAGGTATACAGCACAGGCATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025190.1-2304s1c1
Sequence:CCGGGCAGAAGTTTCTGGAGCACAACTCGAGTTGTGCTCCAGAAACTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025190.1-1323s1c1
Sequence:CCGGCAACCTGCTGCTCTTCTACAACTCGAGTTGTAGAAGAGCAGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-526s21c1
Sequence:CCGGCCTCATGCCTGTGCTGTATACCTCGAGGTATACAGCACAGGCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025190
MSLNL MISSION shRNA Lentiviral Transduction Particles
mesothelin-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-2306s21c1
Sequence:CCGGAGAAGTTTCTGGAGCACAATGCTCGAGCATTGTGCTCCAGAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-461s21c1
Sequence:CCGGCGTGCACACTGTCACCTACATCTCGAGATGTAGGTGACAGTGTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-814s21c1
Sequence:CCGGACCCTCACAGCCCACCTTATTCTCGAGAATAAGGTGGGCTGTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-419s21c1
Sequence:CCGGTCTCATGCCTGTGCTGTATACCTCGAGGTATACAGCACAGGCATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025190.1-2304s1c1
Sequence:CCGGGCAGAAGTTTCTGGAGCACAACTCGAGTTGTGCTCCAGAAACTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025190.1-1323s1c1
Sequence:CCGGCAACCTGCTGCTCTTCTACAACTCGAGTTGTAGAAGAGCAGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025190.1-526s21c1
Sequence:CCGGCCTCATGCCTGTGCTGTATACCTCGAGGTATACAGCACAGGCATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177822
MSLNL MISSION shRNA Bacterial Glycerol Stock
mesothelin-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177822.2-2458s1c1
Sequence:CCGGGCTGTCTCTGACTCCCAGGATCTCGAGATCCTGGGAGTCAGAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-2054s1c1
Sequence:CCGGCCTGTCTGATATGGGCCTATACTCGAGTATAGGCCCATATCAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-2266s1c1
Sequence:CCGGGTCAGTTACCTTCGGGACAAACTCGAGTTTGTCCCGAAGGTAACTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-1800s1c1
Sequence:CCGGACCAGTAATGTGGGAGAATATCTCGAGATATTCTCCCACATTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-1176s1c1
Sequence:CCGGCGCTTCGTTGACAACTTCCTACTCGAGTAGGAAGTTGTCAACGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177822
MSLNL MISSION shRNA shRNA Plasmid DNA
mesothelin-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177822.2-2458s1c1
Sequence:CCGGGCTGTCTCTGACTCCCAGGATCTCGAGATCCTGGGAGTCAGAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-2054s1c1
Sequence:CCGGCCTGTCTGATATGGGCCTATACTCGAGTATAGGCCCATATCAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-2266s1c1
Sequence:CCGGGTCAGTTACCTTCGGGACAAACTCGAGTTTGTCCCGAAGGTAACTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-1800s1c1
Sequence:CCGGACCAGTAATGTGGGAGAATATCTCGAGATATTCTCCCACATTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-1176s1c1
Sequence:CCGGCGCTTCGTTGACAACTTCCTACTCGAGTAGGAAGTTGTCAACGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177822
MSLNL MISSION shRNA Lentiviral Transduction Particles
mesothelin-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177822.2-2458s1c1
Sequence:CCGGGCTGTCTCTGACTCCCAGGATCTCGAGATCCTGGGAGTCAGAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-2054s1c1
Sequence:CCGGCCTGTCTGATATGGGCCTATACTCGAGTATAGGCCCATATCAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-2266s1c1
Sequence:CCGGGTCAGTTACCTTCGGGACAAACTCGAGTTTGTCCCGAAGGTAACTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-1800s1c1
Sequence:CCGGACCAGTAATGTGGGAGAATATCTCGAGATATTCTCCCACATTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177822.2-1176s1c1
Sequence:CCGGCGCTTCGTTGACAACTTCCTACTCGAGTAGGAAGTTGTCAACGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)