EMAIL THIS PAGE TO A FRIEND

MSMB

microseminoprotein, beta-

63 Gene Product Result for
Synonyms: HPC13 IGBF MSP MSPB PN44 PRPS PSP PSP-94 PSP57 PSP94
UniProtKB ID: P08118, B1API6, P11999, Q13125, Q6IAY9, Q9UC59
Gene ID:
Human(4477) Summary: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17695) beta-microseminoprotein
Rat(29311) microseminoprotein, beta
chicken(423773) microseminoprotein, beta-
cow(616019) microseminoprotein, beta-
sheep(101119365) microseminoprotein, beta-
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1652 Human PSP94 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002443 Rosetta Predictions human pricing
NM_138634 Rosetta Predictions human pricing
NM_019188 Rosetta Predictions rat pricing
NM_020597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010761 predicted 203
2 SASI_Hs01_00010762 predicted 199
3 SASI_Hs01_00010763 predicted 209
4 SASI_Hs01_00010764 predicted 211
5 SASI_Hs01_00010765 predicted 280
6 SASI_Hs01_00010766 predicted 348
7 SASI_Hs01_00010767 predicted 254
8 SASI_Hs01_00010768 predicted 346
9 SASI_Hs01_00010769 predicted 231
10 SASI_Hs01_00010770 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215867 predicted 200
2 SASI_Hs01_00215869 predicted 198
3 SASI_Hs01_00215870 predicted 239
4 SASI_Hs01_00215871 predicted 242
5 SASI_Hs01_00215872 predicted 203
6 SASI_Hs01_00215873 predicted 217
7 SASI_Hs01_00215874 predicted 245
8 SASI_Hs01_00215875 predicted 212
9 SASI_Hs01_00215868 predicted 242
10 SASI_Hs01_00215876 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070828 predicted 276
2 SASI_Rn01_00070829 predicted 243
3 SASI_Rn01_00070830 predicted 314
4 SASI_Rn01_00070831 predicted 223
5 SASI_Rn01_00070832 predicted 222
6 SASI_Rn01_00070833 predicted 284
7 SASI_Rn01_00070834 predicted 284
8 SASI_Rn01_00070835 predicted 244
9 SASI_Rn01_00070836 predicted 239
10 SASI_Rn02_00261997 predicted 267
11 SASI_Rn01_00070827 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148825 predicted 223
2 SASI_Mm01_00148826 predicted 253
3 SASI_Mm01_00148827 predicted 225
4 SASI_Mm01_00148828 predicted 230
5 SASI_Mm01_00148829 predicted 206
6 SASI_Mm02_00325695 predicted 245
7 SASI_Mm01_00148832 predicted 265
8 SASI_Mm01_00148833 predicted 258
9 SASI_Mm01_00148834 predicted 229
10 SASI_Mm02_00325696 predicted 261
11 SASI_Mm01_00148830 predicted 257
12 SASI_Mm01_00148831 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002443
MSMB MISSION shRNA Bacterial Glycerol Stock
microseminoprotein, beta-
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002443.2-256s21c1
Sequence:CCGGCACCTGTGGGTTATGACAAAGCTCGAGCTTTGTCATAACCCACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002443.2-206s21c1
Sequence:CCGGGACATGCACTTGCTACGAAACCTCGAGGTTTCGTAGCAAGTGCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002443.2-416s21c1
Sequence:CCGGCATTCTCCTCTGGCCTCTAATCTCGAGATTAGAGGCCAGAGGAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-155s1c1
Sequence:CCGGCAAAGGAAACAAACACCCAATCTCGAGATTGGGTGTTTGTTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-137s1c1
Sequence:CCGGCAGGAAATGCATGGATCTCAACTCGAGTTGAGATCCATGCATTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-352s1c1
Sequence:CCGGGTTCTGTCAGTGAATGGATAACTCGAGTTATCCATTCACTGACAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-228s1c1
Sequence:CCGGGAAATTTCATGTTGCACCCTTCTCGAGAAGGGTGCAACATGAAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-68s1c1
Sequence:CCGGCACCTTCGTGACTTTATGCAACTCGAGTTGCATAAAGTCACGAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002443
MSMB MISSION shRNA shRNA Plasmid DNA
microseminoprotein, beta-
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002443.2-256s21c1
Sequence:CCGGCACCTGTGGGTTATGACAAAGCTCGAGCTTTGTCATAACCCACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002443.2-206s21c1
Sequence:CCGGGACATGCACTTGCTACGAAACCTCGAGGTTTCGTAGCAAGTGCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002443.2-416s21c1
Sequence:CCGGCATTCTCCTCTGGCCTCTAATCTCGAGATTAGAGGCCAGAGGAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-155s1c1
Sequence:CCGGCAAAGGAAACAAACACCCAATCTCGAGATTGGGTGTTTGTTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-137s1c1
Sequence:CCGGCAGGAAATGCATGGATCTCAACTCGAGTTGAGATCCATGCATTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-352s1c1
Sequence:CCGGGTTCTGTCAGTGAATGGATAACTCGAGTTATCCATTCACTGACAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-228s1c1
Sequence:CCGGGAAATTTCATGTTGCACCCTTCTCGAGAAGGGTGCAACATGAAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-68s1c1
Sequence:CCGGCACCTTCGTGACTTTATGCAACTCGAGTTGCATAAAGTCACGAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002443
MSMB MISSION shRNA Lentiviral Transduction Particles
microseminoprotein, beta-
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002443.2-256s21c1
Sequence:CCGGCACCTGTGGGTTATGACAAAGCTCGAGCTTTGTCATAACCCACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002443.2-206s21c1
Sequence:CCGGGACATGCACTTGCTACGAAACCTCGAGGTTTCGTAGCAAGTGCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002443.2-416s21c1
Sequence:CCGGCATTCTCCTCTGGCCTCTAATCTCGAGATTAGAGGCCAGAGGAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-155s1c1
Sequence:CCGGCAAAGGAAACAAACACCCAATCTCGAGATTGGGTGTTTGTTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-137s1c1
Sequence:CCGGCAGGAAATGCATGGATCTCAACTCGAGTTGAGATCCATGCATTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-352s1c1
Sequence:CCGGGTTCTGTCAGTGAATGGATAACTCGAGTTATCCATTCACTGACAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-228s1c1
Sequence:CCGGGAAATTTCATGTTGCACCCTTCTCGAGAAGGGTGCAACATGAAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002443.2-68s1c1
Sequence:CCGGCACCTTCGTGACTTTATGCAACTCGAGTTGCATAAAGTCACGAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020597
MSMB MISSION shRNA Bacterial Glycerol Stock
microseminoprotein, beta-
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-239s1c1
Sequence:CCGGGCCTTTGAGCTATGACAAAGACTCGAGTCTTTGTCATAGCTCAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-141s1c1
Sequence:CCGGGATGGTAACAAGCATTTCCTTCTCGAGAAGGAAATGCTTGTTACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-60s1c1
Sequence:CCGGGTGATAGCATCCAAAGCAGTACTCGAGTACTGCTTTGGATGCTATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-158s1c1
Sequence:CCGGCCTTAACACTCCCTGGAAGAACTCGAGTTCTTCCAGGGAGTGTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020597
MSMB MISSION shRNA shRNA Plasmid DNA
microseminoprotein, beta-
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-239s1c1
Sequence:CCGGGCCTTTGAGCTATGACAAAGACTCGAGTCTTTGTCATAGCTCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-141s1c1
Sequence:CCGGGATGGTAACAAGCATTTCCTTCTCGAGAAGGAAATGCTTGTTACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-60s1c1
Sequence:CCGGGTGATAGCATCCAAAGCAGTACTCGAGTACTGCTTTGGATGCTATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-158s1c1
Sequence:CCGGCCTTAACACTCCCTGGAAGAACTCGAGTTCTTCCAGGGAGTGTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020597
MSMB MISSION shRNA Lentiviral Transduction Particles
microseminoprotein, beta-
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-239s1c1
Sequence:CCGGGCCTTTGAGCTATGACAAAGACTCGAGTCTTTGTCATAGCTCAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-141s1c1
Sequence:CCGGGATGGTAACAAGCATTTCCTTCTCGAGAAGGAAATGCTTGTTACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-60s1c1
Sequence:CCGGGTGATAGCATCCAAAGCAGTACTCGAGTACTGCTTTGGATGCTATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020597.1-158s1c1
Sequence:CCGGCCTTAACACTCCCTGGAAGAACTCGAGTTCTTCCAGGGAGTGTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)