EMAIL THIS PAGE TO A FRIEND

MSMO1

methylsterol monooxygenase 1

98 Gene Product Result for
Synonyms: DESP4 ERG25 SC4MOL
UniProtKB ID: Q15800, A8K8Q3, A8MYF6, D3DP32, Q32Q24
Gene ID:
Human(6307) Summary: Sterol-C4-mehtyl oxidase-like protein was isolated based on its similarity to the yeast ERG25 protein. It contains a set of putative metal binding motifs with similarity to that seen in a family of membrane desaturases-hydroxylases. The protein is localized to the endoplasmic reticulum membrane and is believed to function in cholesterol biosynthesis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(140910) methylsterol monooxygenase 1
domestic guinea pig(100721665) methylsterol monooxygenase 1
naked mole-rat(101719361) methylsterol monooxygenase 1
sheep(101121628) methylsterol monooxygenase 1
Zebrafish(406662) methylsterol monooxygenase 1
cow(504481) methylsterol monooxygenase 1
domestic cat(101096978) methylsterol monooxygenase 1
dog(475491) methylsterol monooxygenase 1
chicken(422423) methylsterol monooxygenase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006745 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004471 MISSION® esiRNA esiRNA targeting human SC4MOL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017369 Rosetta Predictions human pricing
NM_006745 Rosetta Predictions human pricing
NM_080886 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125914 predicted 715
2 SASI_Hs01_00125915 predicted 729
3 SASI_Hs01_00125916 predicted 669
4 SASI_Hs01_00125918 predicted 459
5 SASI_Hs02_00306707 predicted 359
6 SASI_Hs01_00125919 predicted 604
7 SASI_Hs01_00125920 predicted 767
8 SASI_Hs01_00125921 predicted 526
9 SASI_Hs01_00125922 predicted 412
10 SASI_Hs01_00125923 predicted 717
11 SASI_Hs01_00125917 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195806 predicted 999
2 SASI_Hs01_00195807 predicted 1014
3 SASI_Hs01_00195808 predicted 954
4 SASI_Hs01_00195810 predicted 745
5 SASI_Hs02_00342206 predicted 654
6 SASI_Hs01_00195811 predicted 893
7 SASI_Hs01_00195812 predicted 1051
8 SASI_Hs01_00195813 predicted 809
9 SASI_Hs01_00195814 predicted 700
10 SASI_Hs01_00195815 predicted 1004
11 SASI_Hs01_00195809 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042132 predicted 301
2 SASI_Rn01_00042133 predicted 661
3 SASI_Rn01_00042134 predicted 377
4 SASI_Rn01_00042135 predicted 285
5 SASI_Rn01_00042137 predicted 694
6 SASI_Rn01_00042138 predicted 887
7 SASI_Rn01_00042139 predicted 257
8 SASI_Rn01_00042140 predicted 529
9 SASI_Rn01_00042141 predicted 276
10 SASI_Rn02_00267338 predicted 1057
11 SASI_Rn01_00042136 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006745
VALIDATED
MSMO1 MISSION shRNA Bacterial Glycerol Stock
methylsterol monooxygenase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-420s1c1
Sequence:CCGGGCCTTTGATTTGTGGAACCTACTCGAGTAGGTTCCACAAATCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006745.2-834s1c1
Sequence:CCGGGCATCATGATTTCCACCACATCTCGAGATGTGGTGGAAATCATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-915s1c1
Sequence:CCGGCTCTCAGTATAATGCCTATAACTCGAGTTATAGGCATTATACTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-163s1c1
Sequence:CCGGCCTGAGAATCCTCTGCAAGAACTCGAGTTCTTGCAGAGGATTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-558s1c1
Sequence:CCGGGCATAGACTCTTACACCACAACTCGAGTTGTGGTGTAAGAGTCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-465s21c1
Sequence:CCGGTGATTTGTGGAACCTATTATTCTCGAGAATAATAGGTTCCACAAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-775s21c1
Sequence:CCGGATGGGTGACCATTCGTTTATTCTCGAGAATAAACGAATGGTCACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-1398s21c1
Sequence:CCGGTAGTGGTATTGGCCTTATATTCTCGAGAATATAAGGCCAATACCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006745.3-574s21c1
Sequence:GTACCGGTGAAGATACTTGGCACTATTTCTCGAGAAATAGTGCCAAGTATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-956s21c1
Sequence:CCGGTCTCAGTATAATGCCTATAATCTCGAGATTATAGGCATTATACTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006745
VALIDATED
MSMO1 MISSION shRNA shRNA Plasmid DNA
methylsterol monooxygenase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-420s1c1
Sequence:CCGGGCCTTTGATTTGTGGAACCTACTCGAGTAGGTTCCACAAATCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006745.2-834s1c1
Sequence:CCGGGCATCATGATTTCCACCACATCTCGAGATGTGGTGGAAATCATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-915s1c1
Sequence:CCGGCTCTCAGTATAATGCCTATAACTCGAGTTATAGGCATTATACTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-163s1c1
Sequence:CCGGCCTGAGAATCCTCTGCAAGAACTCGAGTTCTTGCAGAGGATTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-558s1c1
Sequence:CCGGGCATAGACTCTTACACCACAACTCGAGTTGTGGTGTAAGAGTCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-465s21c1
Sequence:CCGGTGATTTGTGGAACCTATTATTCTCGAGAATAATAGGTTCCACAAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-775s21c1
Sequence:CCGGATGGGTGACCATTCGTTTATTCTCGAGAATAAACGAATGGTCACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-1398s21c1
Sequence:CCGGTAGTGGTATTGGCCTTATATTCTCGAGAATATAAGGCCAATACCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006745.3-574s21c1
Sequence:GTACCGGTGAAGATACTTGGCACTATTTCTCGAGAAATAGTGCCAAGTATCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-956s21c1
Sequence:CCGGTCTCAGTATAATGCCTATAATCTCGAGATTATAGGCATTATACTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006745
VALIDATED
MSMO1 MISSION shRNA Lentiviral Transduction Particles
methylsterol monooxygenase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-420s1c1
Sequence:CCGGGCCTTTGATTTGTGGAACCTACTCGAGTAGGTTCCACAAATCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006745.2-834s1c1
Sequence:CCGGGCATCATGATTTCCACCACATCTCGAGATGTGGTGGAAATCATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-915s1c1
Sequence:CCGGCTCTCAGTATAATGCCTATAACTCGAGTTATAGGCATTATACTGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-163s1c1
Sequence:CCGGCCTGAGAATCCTCTGCAAGAACTCGAGTTCTTGCAGAGGATTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006745.2-558s1c1
Sequence:CCGGGCATAGACTCTTACACCACAACTCGAGTTGTGGTGTAAGAGTCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-465s21c1
Sequence:CCGGTGATTTGTGGAACCTATTATTCTCGAGAATAATAGGTTCCACAAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-775s21c1
Sequence:CCGGATGGGTGACCATTCGTTTATTCTCGAGAATAAACGAATGGTCACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-1398s21c1
Sequence:CCGGTAGTGGTATTGGCCTTATATTCTCGAGAATATAAGGCCAATACCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006745.3-574s21c1
Sequence:GTACCGGTGAAGATACTTGGCACTATTTCTCGAGAAATAGTGCCAAGTATCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006745.3-956s21c1
Sequence:CCGGTCTCAGTATAATGCCTATAATCTCGAGATTATAGGCATTATACTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)