EMAIL THIS PAGE TO A FRIEND

MSMP

microseminoprotein, prostate associated

42 Gene Product Result for
Synonyms: PSMP
UniProtKB ID: Q1L6U9
Gene ID:
Human(692094) Summary: This gene encodes a member of the beta-microseminoprotein family. Members of this protein family contain ten conserved cysteine residues that form intra-molecular disulfide bonds. The encoded protein may play a role in prostate cancer tumorigenesis. [provided by RefSeq, Jan 2011]
Mouse(100039672) microseminoprotein, prostate associated
Rat(100359704) microseminoprotein, prostate associated
chicken(769825) microseminoprotein, prostate associated
domestic cat(101094056) microseminoprotein, prostate associated
cow(100295064) microseminoprotein, prostate associated
dog(611944) microseminoprotein, prostate associated
sheep(101113462) microseminoprotein, prostate associated
naked mole-rat(101720427) microseminoprotein, prostate associated
domestic guinea pig(100731747) microseminoprotein, prostate associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001044264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001044264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001044264 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001044264 Rosetta Predictions human pricing
NM_001099314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311292 predicted 439
2 SASI_Hs02_00311293 predicted 437
3 SASI_Hs02_00311294 predicted 335
4 SASI_Hs02_00311295 predicted 233
5 SASI_Hs02_00311296 predicted 312
6 SASI_Hs02_00311297 predicted 255
7 SASI_Hs02_00311298 predicted 332
8 SASI_Hs02_00311299 predicted 207
9 SASI_Hs02_00311300 predicted 426
10 SASI_Hs02_00311301 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301695 predicted 416
2 SASI_Mm02_00301696 predicted 327
3 SASI_Mm02_00301697 predicted 456
4 SASI_Mm02_00301698 predicted 328
5 SASI_Mm02_00301699 predicted 313
6 SASI_Mm02_00301700 predicted 362
7 SASI_Mm02_00301701 predicted 469
8 SASI_Mm02_00301702 predicted 354
9 SASI_Mm02_00301703 predicted 234
10 SASI_Mm02_00301704 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099314
MSMP MISSION shRNA Bacterial Glycerol Stock
microseminoprotein, prostate associated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-323s21c1
Sequence:CCGGGGAGTTAGCAGCAAGTGTTACCTCGAGGTAACACTTGCTGCTAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-361s21c1
Sequence:CCGGCTGCCACTACGAGGGTAAATACTCGAGTATTTACCCTCGTAGTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-461s21c1
Sequence:CCGGGACACGGCTCAGCATCCTATTCTCGAGAATAGGATGCTGAGCCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-406s21c1
Sequence:CCGGCCGCAAGGACTGTTTCCATTGCTCGAGCAATGGAAACAGTCCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-511s21c1
Sequence:CCGGGGAGGCAGGAACCTGTCAATTCTCGAGAATTGACAGGTTCCTGCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099314
MSMP MISSION shRNA shRNA Plasmid DNA
microseminoprotein, prostate associated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-323s21c1
Sequence:CCGGGGAGTTAGCAGCAAGTGTTACCTCGAGGTAACACTTGCTGCTAACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-361s21c1
Sequence:CCGGCTGCCACTACGAGGGTAAATACTCGAGTATTTACCCTCGTAGTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-461s21c1
Sequence:CCGGGACACGGCTCAGCATCCTATTCTCGAGAATAGGATGCTGAGCCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-406s21c1
Sequence:CCGGCCGCAAGGACTGTTTCCATTGCTCGAGCAATGGAAACAGTCCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-511s21c1
Sequence:CCGGGGAGGCAGGAACCTGTCAATTCTCGAGAATTGACAGGTTCCTGCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099314
MSMP MISSION shRNA Lentiviral Transduction Particles
microseminoprotein, prostate associated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-323s21c1
Sequence:CCGGGGAGTTAGCAGCAAGTGTTACCTCGAGGTAACACTTGCTGCTAACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-361s21c1
Sequence:CCGGCTGCCACTACGAGGGTAAATACTCGAGTATTTACCCTCGTAGTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-461s21c1
Sequence:CCGGGACACGGCTCAGCATCCTATTCTCGAGAATAGGATGCTGAGCCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-406s21c1
Sequence:CCGGCCGCAAGGACTGTTTCCATTGCTCGAGCAATGGAAACAGTCCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099314.1-511s21c1
Sequence:CCGGGGAGGCAGGAACCTGTCAATTCTCGAGAATTGACAGGTTCCTGCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001044264
MSMP MISSION shRNA Bacterial Glycerol Stock
microseminoprotein, prostate associated
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-303s21c1
Sequence:CCGGTTTACCCTGGGTGAGTCTTGGCTCGAGCCAAGACTCACCCAGGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-325s21c1
Sequence:CCGGTCCGCAAGGACTGTTTCCATTCTCGAGAATGGAAACAGTCCTTGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-247s21c1
Sequence:CCGGTCTACAGCAAGTGCTACTTCCCTCGAGGGAAGTAGCACTTGCTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-201s21c1
Sequence:CCGGGGGATCATCTGCTTGGTGATGCTCGAGCATCACCAAGCAGATGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-445s21c1
Sequence:CCGGGCCAGTTCTCCTTGGTGCAAACTCGAGTTTGCACCAAGGAGAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001044264
MSMP MISSION shRNA shRNA Plasmid DNA
microseminoprotein, prostate associated
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-303s21c1
Sequence:CCGGTTTACCCTGGGTGAGTCTTGGCTCGAGCCAAGACTCACCCAGGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-325s21c1
Sequence:CCGGTCCGCAAGGACTGTTTCCATTCTCGAGAATGGAAACAGTCCTTGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-247s21c1
Sequence:CCGGTCTACAGCAAGTGCTACTTCCCTCGAGGGAAGTAGCACTTGCTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-201s21c1
Sequence:CCGGGGGATCATCTGCTTGGTGATGCTCGAGCATCACCAAGCAGATGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-445s21c1
Sequence:CCGGGCCAGTTCTCCTTGGTGCAAACTCGAGTTTGCACCAAGGAGAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001044264
MSMP MISSION shRNA Lentiviral Transduction Particles
microseminoprotein, prostate associated
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-303s21c1
Sequence:CCGGTTTACCCTGGGTGAGTCTTGGCTCGAGCCAAGACTCACCCAGGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-325s21c1
Sequence:CCGGTCCGCAAGGACTGTTTCCATTCTCGAGAATGGAAACAGTCCTTGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-247s21c1
Sequence:CCGGTCTACAGCAAGTGCTACTTCCCTCGAGGGAAGTAGCACTTGCTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-201s21c1
Sequence:CCGGGGGATCATCTGCTTGGTGATGCTCGAGCATCACCAAGCAGATGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044264.1-445s21c1
Sequence:CCGGGCCAGTTCTCCTTGGTGCAAACTCGAGTTTGCACCAAGGAGAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)